JCM Figure table search 04
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
JCM.01145-07v1
45/11/3821    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Coutlée, F.
Right arrow Articles by Franco, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Coutlée, F.
Right arrow Articles by Franco, E.
Journal of Clinical Microbiology, November 2007, p. 3821-3823, Vol. 45, No. 11
0095-1137/07/$08.00+0     doi:10.1128/JCM.01145-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Confirmatory Real-Time PCR Assay for Human Papillomavirus (HPV) Type 52 Infection in Anogenital Specimens Screened for HPV Infection with the Linear Array HPV Genotyping Test{triangledown}

François Coutlée,1,2,3* Danielle Rouleau,1,2 Georges Ghattas,1 Catherine Hankins,3,4 Sylvie Vézina,5 Pierre Coté,6 John Macleod,3 Alexandra de Pokomandy,1 Deborah Money,7 Sharon Walmsley,8 Hélène Voyer,1 Paul Brassard,3 and Eduardo Franco3

Laboratoire de Virologie Moléculaire, Centre de Recherche, et Départements de Microbiologie et Infectiologie, de Médecine Familiale et Gastro-entérologie, Hôpital Notre-Dame du Centre Hospitalier de l'Université de Montréal, Montréal, Québec, Canada,1 Département de Microbiologie et Immunologie, Université de Montréal, Montréal, Québec, Canada,2 Division of Cancer Epidemiology and Department of Medicine, McGill University, Montreal, Québec, Canada,3 Direction de la Santé Publique de Montréal-Centre, Institut National de Santé Publique du Québec, Montréal, Québec, Canada,4 Clinique Médicale l'Actuel, Montréal, Québec, Canada,5 Clinique Médicale du Quartier-Latin, Montréal, Québec, Canada,6 Department of Obstetrics and Gynecology, University of British Columbia, Vancouver, British Columbia, Canada,7 Division of Clinical Investigation and Human Physiology, Toronto General Research Institute, Toronto General Hospital, University of Toronto, Toronto, Ontario, Canada8

Received 7 June 2007/ Returned for modification 19 August 2007/ Accepted 15 September 2007


    ABSTRACT
 Top
 ABSTRACT
 TEXT
 REFERENCES
 
A novel real-time PCR assay for detection of human papillomavirus type 52 (HPV-52) DNA (RT-52) was evaluated on 265 anogenital samples. RT-52 had a sensitivity of 98.4% and a specificity of 100% compared to conventional HPV-52 typing assays, including hybridization of PGMY products with an HPV-52-specific probe and PCR sequencing of HPV-52 E6.


    TEXT
 Top
 ABSTRACT
 TEXT
 REFERENCES
 
The detection of high-risk human papillomavirus (HPV) types in genital specimens has now been approved in several countries for the triage of women with a cytological diagnosis of atypical squamous cells of undetermined significance (ASCUS) and for the primary screening for cervical cancer for women aged 30 years and above as an adjunct to cytology (18). HPV DNA genotyping has proven useful in the study of the natural history and transmission of HPV infection (9, 15). Genotyping assays will be instrumental in assessing the impact of HPV vaccination on the risk of acquisition and on the distribution of individual HPV types in a population. Moreover, HPV genotyping could identify HPV-infected women at greater risk for high-grade cervical intraepithelial neoplasia or cancer (2, 13, 15).

The Linear Array HPV genotyping test (LA-HPV) from Roche Molecular Systems is approved by Health Canada for HPV genotyping. LA-HPV identifies 36 genotypes by hybridization on a linear array of PGMY-generated amplicons with 34 type-specific probes for HPV-6, -11, -16, -18, -26, -31, -33, -35, -39, -40, -42, -45, -51, -53, -54, -55, -56, -58, -59, -61, -62, -64, -66, -67, -68, -69, -70, -71, -72, -73, -81, -83, -84, and -89, two probes for two subtypes of HPV-82, and one probe that cross-reacts with HPV-33, -35, -52, and -58 (8). A sample is thus considered positive for HPV-52 when it reacts with the HPV-52-cross-reactive probe but not with the HPV-33, -35, or -58 type-specific individual probes. However, LA-HPV cannot establish the presence of HPV-52 DNA in a sample reacting with the HPV-33/35/52/58-cross-reactive probe and with at least one of the HPV type-specific probe for HPV-33, -35, or -58. If these samples are considered positive for HPV-52, the prevalence of HPV-52 will be overestimated, and if they are considered negative, HPV-52 prevalence may be underestimated.

HPV-52 is the seventh most frequently detected high-risk type in invasive cervical cancer worldwide (5) and causes 8.8% of low-grade and 2.5% of high-grade squamous intraepithelial lesions (4). It is thus imperative in epidemiological studies to be able to determine if HPV-52 is truly present in samples reacting with the HPV-52-cross-reactive probe and containing another type reacting with that probe. We present here the results of the validation of a novel real-time PCR assay for the rapid confirmation of HPV-52 infection in specimens positive with the HPV-52 cross-reacting probe in the LA-HPV test.

Clinical specimens. Overall, 265 genital specimens collected from 95 women and 170 men participating in four studies described elsewhere (8, 11, 14, 16) were selected on the basis of previous testing of PGMY-generated amplicons with the cross-reacting HPV-33/35/52/58 probe and with conventional HPV-52 typing methods (see below). Anal swabs were collected in Preservcyt (Cytyc Corporation, Boxborough, MA) from 170 men in the HIPVIRG cohort with low-grade anal intraepithelial neoplasia (AIN) (n = 74), high-grade AIN (n = 56), AIN of unknown grade (n = 4), or no AIN (n = 36), and DNA was extracted as previously described (8). Cervical samples were collected and processed as previously described from 53 women recruited in The Canadian Women's HIV Study with a normal cytology (n = 47) or low-grade squamous intraepithelial lesion (n = 6) (11, 16). Cervical Cytobrush samples collected from 26 women participating in the Biomarkers of Cervical Cancer Risk case-control study (14) and from 16 Inuit women participating in a cohort study in northern Quebec were processed as described for anal samples above. Each participant had given written informed consent for HPV testing. All studies had been approved by the research ethics committees of participating institutions.

Consensus HPV DNA testing and genotyping. After amplification with PGMY primers, 50 samples tested negative and 215 tested positive with the cross-reacting HPV-33/35/52/58 probe with LA-HPV (n = 223) or with the research prototype of LA-HPV, the line blot assay (n = 42) (8, 10). Of the 215 samples positive with the cross-reacting HPV-33/35/52/58 probe, 102 samples tested positive for HPV-52 in conventional typing assays, which consisted of hybridization of PGMY amplicons with an array using an HPV-52-specific probe (n = 210) (7, 10) and/or of PCR sequencing of the HPV-52 long control region and E6 gene (n = 10) (1). The array with an HPV-52-specific probe had compared favorably to an assay using radiolabeled probes in previous evaluations (6, 7). All samples tested positive for ß-globin (8).

RT-52. All 265 samples were tested for HPV-52 DNA with a real-time HPV-52 PCR (RT-52) in a 20-µl reaction mixture containing 10 mM Tris-HCl (pH 8.0), 50 mM KCl, 200 µM each dATP, dGTP, dCTP, and 400 µM dUTP, 0.05 µM of TaqMan probe 52-TM (CGTGCAGGGTCCGGGGTC), 0.3 pmol each of primers 52JA-3 (GAACACAGTGTAGCTAACGCACG) and 52JA-4 (GCATGACGTTACACTTGGGTCA) (located in conserved areas of E6 [14]), 2.0 mM MgCl2, and 5 units of AmpliTaq Gold DNA polymerase, in a Light Cycler PCR and detection system (Roche Molecular Systems) at 95°C for 10 min, followed by 50 cycles at 95°C for 15 s and at 60°C for 60 s. The temperature profile and magnesium content were optimized with HPV-52 DNA dilutions (data not shown). The optimized assay could consistently detect as few as 10 HPV-52 copies per assay (data not shown). No signal was obtained with the RT-52 assay with 1,000,000 copies of HPV-6, -11, -16, -18, 31, -33, -35, -45, or -66 DNA.

Performance of RT-52. The distribution of types detected in 265 samples with consensus PGMY HPV DNA amplification and typing with the probe array is shown in Table 1. There was a mean of 5.1 HPV types per sample (95% confidence interval [CI], 4.7 to 5.5; range, 0 to 18). Of the 215 samples reacting with the cross-reacting HPV-33/35/52/58 probe, HPV-33, -35, and/or -58 was detected in 170 samples with the consensus PGMY HPV DNA assay. The high detection rates of HPV-33, -35, and -58 reflected in part the fact that these types cross-reacted with the HPV-52 probe in the screening assays and had been preferentially selected for further confirmation of HPV-52 infection. One hundred two samples contained HPV-52 DNA according to conventional typing assays for HPV-52 as described above.


View this table:
[in this window]
[in a new window]

 
TABLE 1. HPV types detected in 265 anogenital samples with PGMY amplification and typing with 36 type-specific probes and the HPV-33/35/52/58-cross-reactive probea

 
Of the 265 samples evaluated, 100 tested positive with RT-52 (Table 2). RT-52-positive and -negative specimens contained a mean of 6.6 (95% CI, 5.9 to 7.3; range, 0 to 18) and 4.3 (95% CI, 3.8 to 4.7; range, 0 to 16) HPV types per sample, respectively. The sensitivity and specificity of RT-52 were 98.0% (95% CI, 92.7 to 100.0%) and 100% (95% CI, 97.3 to 100.0%), respectively. Identical results with RT-52 and conventional HPV-52 typing methods were obtained for 263 of 265 samples, for an agreement of 99.3% (95% CI, 97.1 to 100.0%) and a kappa value of 0.98 (95% CI, 0.86 to 1.00). The two samples falsely negative by RT-52 contained 10 and 7 HPV types, respectively. Signals obtained with the HPV-52-specific probe were very weak for both samples, and PCR inhibition was demonstrated in one sample using an HPV-52 internal control (data not shown).


View this table:
[in this window]
[in a new window]

 
TABLE 2. Comparison in 265 anogenital samples of HPV-52 DNA detection with RT-52 and conventional HPV-52-specific typing of PGMY-generated ampliconsa

 
RT-52 is shown here to be a reliable tool to confirm the presence of HPV-52 in samples screened by LA-HPV and positive with the HPV-52 cross-reacting probe in the presence of HPV-33, -35, or -58. Real-time PCR is an attractive alternative to confirm the presence of HPV-52 in samples positive with the cross-reacting HPV-52 probe and containing several HPV types. Up to 2.6% of women with normal cytology smears (3) and even more women with cervical intraepithelial neoplasia 2 or 3 or cancer (12) are infected with multiple HPV types. Individuals infected with human immunodeficiency virus are also at greater risk for multiple-type infections (8). Rapid testing of samples can be accomplished with real-time PCR. Sequence mismatches in primers and/or probes with viral sequences can impede efficiency of amplification or hybridization reaction in real-time PCR (17). However, HPV-52 E6 reagents were selected in conserved sequences among HPV-52 variants (1). In the future, RT-52 could become a quantitative tool to measure HPV-52 viral load by using an HPV-52 internal control and cellular gene control.


    ACKNOWLEDGMENTS
 
We thank Jean-Marc Trépanier and Serge Coté for maintenance of the database from the HIPVIRG study and sampling of men, and we thank Diane Gaudreault and Diane Bronsard for processing genital samples in The Canadian Women's HIV Study.

This work was supported by the Réseau FRSQ-SIDA Maladies Infectieuses. The National Cancer Institute of Canada supports the HIPVIRG cohort. The Canadian Institutes for Health Research and Health and Welfare Canada supported the Canadian Women's HIV Study. F.C. and P.B. are clinical research scholars supported by the Fonds de Recherche en Santé du Québec. E.F. holds a Distinguished Scientist Award from the Canadian Institutes for Health Research. S.W. holds career scientist salary support from the Ontario HIV treatment network.


    FOOTNOTES
 
* Corresponding author. Mailing address: Département de Microbiologie et Infectiologie, Hôpital Notre-Dame du Centre Hospitalier de l'Université de Montréal, 1560 Sherbrooke est, Montréal (Québec), H2L 4M1, Canada. Phone: (514) 890-8000, ext. 25162. Fax: (514) 412-7512. E-mail: francois.coutlee{at}ssss.gouv.qc.ca Back

{triangledown} Published ahead of print on 26 September 2007. Back


    REFERENCES
 Top
 ABSTRACT
 TEXT
 REFERENCES
 

  1. Aho, J., C. Hankins, C. Tremblay, F. Lang, P. Forest, K. Pourreaux, F. Rouah, The Canadian Women's HIV Study Group, and F. Coutlée. 2003. Molecular analysis of human papillomavirus type 52 isolates detected in the genital tract of HIV-seropositive and seronegative women. J. Infect. Dis. 188:1517-1527.[CrossRef][Medline]
  2. Castle, P. E., D. Solomon, M. Schiffman, and C. M. Wheeler. 2005. Human papillomavirus type 16 infections and 2-year absolute risk of cervical precancer in women with equivocal or mild cytologic abnormalities. J. Natl. Cancer Inst. 97:1066-1071.[Abstract/Free Full Text]
  3. Clifford, G. M., S. Gallus, R. Herrero, N. Munoz, P. J. Snijders, S. Vaccarella, P. T. Anh, C. Ferreccio, N. T. Hieu, E. Matos, M. Molano, R. Rajkumar, G. Ronco, S. de-Sanjose, H. R. Shin, S. Sukvirach, J. O. Thomas, S. Tunsakul, C. J. Meijer, and S. Franceschi. 2005. Worldwide distribution of human papillomavirus types in cytologically normal women in the International Agency for Research on CancerHPV prevalence surveys: a pooled analysis. Lancet 366:991-998.[CrossRef][Medline]
  4. Clifford, G. M., R. K. Rana, S. Franceschi, J. S. Smith, G. Gough, and J. M. Pimenta. 2005. Human papillomavirus genotype distribution in low-grade cervical lesions: comparison by geographic region and with cervical cancer. Cancer Epidemiol. Biomarkers Prev. 14:1157-1164.[Abstract/Free Full Text]
  5. Clifford, G. M., J. S. Smith, M. Plummer, N. Munoz, and S. Franceschi. 2003. Human papillomavirus types in invasive cervical cancer worldwide: a meta-analysis. Br. J. Cancer 88:63-73.[CrossRef][Medline]
  6. Coutlée, F., P. Gravitt, H. Richardson, C. Hankins, E. Franco, N. Lapointe, H. Voyer, and The Canadian Women's HIV Study Group. 1999. Nonisotopic detection and typing of human papillomavirus DNA in genital samples by the line blot assay. J. Clin. Microbiol. 37:1852-1857.[Abstract/Free Full Text]
  7. Coutlée, F., P. Gravitt, J. Kornegay, C. Hankins, H. Richardson, J. R. Lapointe, H. Voyer, The Canadian Women's HIV Study Group, and E. L. Franco. 2002. Use of PGMY primers in L1 consensus PCR improves detection of human papillomavirus DNA in genital samples. J. Clin. Microbiol. 40:902-907.[Abstract/Free Full Text]
  8. Coutlee, F., D. Rouleau, P. Petignat, G. Ghattas, J. Kornegay, P. Schlagg, S. Boyle, C. Hankins, D. Vézina, P. Cote, J. Macleod, H. Voyer, P. Forest, S. Walmsley, and E. L. Franco. 2006. Enhanced detection and typing of human papillomavirus DNA in anogenital samples with PGMY primers and the Linear Array HPV genotyping test. J. Clin. Microbiol. 44:1998-2006.[Abstract/Free Full Text]
  9. Ferenczy, A., and E. L. Franco. 2002. Persistent human papillomavirus infection and cervical neoplasia. Lancet Oncol. 3:11-16.[CrossRef][Medline]
  10. Gravitt, P., C. L. Peyton, T. Q. Alessi, C. Wheeler, F. Coutlée, A. Hildesheim, M. Schiffman, D. R. Scott, and R. J. Apple. 2000. Improved amplification of genital human papillomaviruses. J. Clin. Microbiol. 38:357-361.[Abstract/Free Full Text]
  11. Hankins, C., F. Coutlee, N. Lapointe, P. Simard, T. Tran, J. Samson, L. Hum, and The Canadian Women's HIV Study Group. 1999. Prevalence of risk factors associated with human papillomavirus infection in women living with HIV. Can. Med. Assoc. J. 160:185-191.[Abstract]
  12. Herrero, R., P. E. Castle, M. Schiffman, M. C. Bratti, A. Hildesheim, J. Morales, M. Alfaro, M. E. Sherman, S. Wacholder, S. Chen, A. C. Rodriguez, and R. D. Burk. 2005. Epidemiologic profile of type-specific human papillomavirus infection and cervical neoplasia in Guanacaste, Costa Rica. J. Infect. Dis. 191:1796-1807.[CrossRef][Medline]
  13. Khan, M. J., P. E. Castle, A. T. Lorincz, S. Wacholder, M. Sherman, D. R. Scott, B. B. Rush, A. G. Glass, and M. Schiffman. 2005. The elevated 10-year risk of cervical precancer and cancer in women with human papillomavirus (HPV) type 16 or 18 and the possible utility of type-specific HPV testing in clinical practice. J. Natl. Cancer Inst. 97:1072-1079.[Abstract/Free Full Text]
  14. Koushik, A., A. Ghosh, E. Duarte-Franco, P. Forest, H. Voyer, G. Matlashewski, F. Coutlee, and E. L. Franco. 2005. The p53 codon 72 polymorphism and risk of high-grade cervical intraepithelial neoplasia. Cancer Det. Prev. 29:307-316.[CrossRef]
  15. Meijer, C. J., P. J. Snijders, and P. E. Castle. 2006. Clinical utility of HPV genotyping. Gynecol. Oncol. 103:12-17.[CrossRef][Medline]
  16. Petignat, P., C. Hankins, S. Walmsley, D. Money, D. Provencher, K. Pourreaux, J. Kornegay, F. Rouah, and F. Coutlee. 2005. Self-sampling is associated with increased detection of human papillomavirus DNA in the genital tract of HIV-seropositive women. Clin. Infect. Dis. 41:527-534.[CrossRef][Medline]
  17. Whiley, D. M., and T. P. Sloots. 2005. Sequence variation in primer targets affects the accuracy of viral quantitative PCR. J. Clin. Virol. 34:104-107.[CrossRef][Medline]
  18. Wright, T. C. J., M. Schiffman, D. Solomon, J. T. Cox, F. Garcia, S. Goldie, K. Hatch, K. L. Noller, N. Roach, C. Runowicz, and D. Saslow. 2004. Interim guidance for the use of human papillomavirus DNA testing as an adjunct to cervical cytology for screening. Obstet. Gynecol. 103:304-309.[Abstract/Free Full Text]


Journal of Clinical Microbiology, November 2007, p. 3821-3823, Vol. 45, No. 11
0095-1137/07/$08.00+0     doi:10.1128/JCM.01145-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
JCM.01145-07v1
45/11/3821    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Coutlée, F.
Right arrow Articles by Franco, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Coutlée, F.
Right arrow Articles by Franco, E.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Antimicrob. Agents Chemother. Clin. Microbiol. Rev.
Clin. Vaccine Immunol. ALL ASM JOURNALS