This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pounder, J. I.
Right arrow Articles by Petti, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pounder, J. I.
Right arrow Articles by Petti, C. A.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, February 2007, p. 568-571, Vol. 45, No. 2
0095-1137/07/$08.00+0     doi:10.1128/JCM.01684-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Discovering Potential Pathogens among Fungi Identified as Nonsporulating Molds{triangledown}

June I. Pounder,1* Keith E. Simmon,1 Claudia A. Barton,2 Sheri L. Hohmann,2 Mary E. Brandt,3 and Cathy A. Petti1,2,4

Associated Regional and University Pathologists, Inc., Institute for Clinical and Experimental Pathology, Salt Lake City, Utah,1 Associated Regional and University Pathologists, Inc., Infectious Diseases Laboratory, Salt Lake City, Utah,2 Centers for Disease Control and Prevention, Mycotic Disease Branch, Atlanta, Georgia,3 University of Utah School of Medicine, Salt Lake City, Utah4

Received 15 August 2006/ Returned for modification 12 October 2006/ Accepted 15 November 2006


arrow
ABSTRACT
 
Fungal infections are increasing, particularly among immunocompromised hosts, and a rapid diagnosis is essential to initiate antifungal therapy. Often fungi cannot be identified by conventional methods and are classified as nonsporulating molds (NSM).We sequenced internal transcribed spacer regions from 50 cultures of NSM and found 16 potential pathogens that can be associated with clinical disease. In selected clinical settings, identification of NSM could prove valuable and have an immediate impact on patient management.


arrow
TEXT
 
Fungal infections are increasing, particularly among immunocompromised hosts, and a rapid, accurate diagnosis is essential for the initiation of targeted antifungal therapy. Diagnosis of fungal infections usually depends on recovery of fungi from culture of clinical specimens, and their identification requires the presence of reproductive structures. Often fungi cannot be characterized fully because the mold does not sporulate, making identification by microscopic morphology not possible and potentially increasing the time to report an inconclusive result to 21 days. While many laboratorians and clinicians assume that these fungal isolates are environmental organisms and not clinically significant, to our knowledge no study has systematically attempted to classify these previously unidentifiable fungi in a clinical microbiology laboratory.

Amplification and sequencing of target regions within the ribosomal DNA gene complex has emerged as a useful, adjunctive tool for the identification of fungi and does not depend on mold sporulation for identification (3, 5, 9, 11). The internal transcribed spacer (ITS) regions 1 and 2 located between the highly conserved small (18S) and large (28S) ribosomal subunit genes in the rRNA operon are known to have sufficient sequence variability to allow identification to the species level for many fungi (2, 3, 5, 9, 11, 15). The goals of this study were to determine if sequencing the ITS 1 and 2 regions of nonsporulating molds (NSM) could identify fungi that were not identifiable by conventional methods and could serve as an approach to detect clinically relevant pathogens.

Sample selection. Identification of molds directly from a specimen or submitted as an isolated culture to Associated Regional and University Pathologists, Inc., Laboratories (ARUP Laboratories) was attempted by growth on inhibitory mold agar, modified Sabouraud agars, or potato dextrose agar. Microscopic structures were observed on tease or tape preparations and slide cultures for up to 21 days. NSM were defined as molds without reproductive structures and that could not be further characterized. From 1 January 2005 to 1 January 2006, clinical isolates classified as NSM were randomly selected for gene amplification and sequencing.

DNA preparation. After growth for 1 to 7 days on potato dextrose agar slants, lysates were prepared from approximately 1 cm2 of mycelia with IDI lysis kits (GeneOhm Sciences, San Diego, CA). Briefly, in a biological safety cabinet, mycelia were collected by scraping the slant with a sterile stick in 1 ml of sterile, molecular-grade H2O. The material was transferred to a 2-ml screw-cap tube. The tubes were centrifuged for 1 min at 6,000 x g. If the mycelia did not pellet, the material was contained with a pediatric blood serum filter (Porex Corp., Fairburn, GA). Supernatant was removed. The material was resuspended in 200 µl of IDI sample buffer and transferred to the lysis tube, which contained glass beads. Lysis tubes were vortexed on the highest setting for 5 min. The tubes were placed in a boiling water bath for 15 min. Tubes were centrifuged for 5 min at 16,000 x g. The supernatant was stored at –20°C until amplification.

Amplification and sequencing. Real-time PCR with SYBR green DNA binding dye and amplicon melting temperature analysis was performed on the RotorGene 3000 (Corbett Robotics, Inc., Sydney, Australia). PCR mixtures contained the following: 1x Lightcycler FastStart DNA Master Hybridization Probes mixture (Roche Applied Science, Penzberg, Germany), which contained deoxynucleoside triphosphates, FastStart Taq DNA polymerase, and 1 mM MgCl2 (additional MgCl2 was added to a final concentration of 4.6 mM); 0.4 µM each of ITS1 forward (5'TCCGTAGGTGAACCTGCGG3') and ITS4 reverse (5'TCCTCCGCTTATTGATATGC3') primers (15); 1x SYBR green (Molecular Probes, Inc. Eugene, OR); and 3 µl template DNA. Thermal cycling parameters with RotorGene 3000 were 95°C for 10 min; 50 cycles of 95°C for 5 s, 60°C for 20 s, and 76°C for 30 s; and a final extension at 72°C for 2 min. The quality of the amplicon was determined using the derivative of the melt analysis curve (55°C to 99°C, 45-s hold at 55°C, 5 s/°C). The amplified product was processed for bidirectional sequencing using ExoSAP-IT (USB Corp., Cleveland, OH). Five microliters of Big Dye Terminator Ready Reaction Mix v. 1.1 (Applied Biosystems, Inc., Foster City, CA) was added to 4 µl of each primer (0.8 pmol/µl) and 3 µl of purified PCR product. Cycle sequencing was performed with a 9700 thermal cycler (ABI), using 25 cycles of 96°C for 10 s, 50°C for 5 s, and 60°C for 4 min. Sequencing reaction products were passed through a Sephadex G-50 fine column to remove unincorporated dye terminators. Purified sequencing reaction products were read on an ABI Prism 3100 Genetic Analyzer with a 50-cm capillary array.

Sequences were analyzed with the SmartGene Integrated Database Network (SmartGene Inc., Raleigh, NC) software version 3.2.3 vr. SmartGene is a web-based software and database system with reference sequences derived from the National Center for Biological Information (NCBI) GenBank repository. Phylogenetic trees and alignments of reference sequences with ≥98% identity to NSM isolate sequences were created using Clustalx v1.83 (University of British Columbia Bioinformatics Centre).

Nucleotide sequences with match lengths of ≥400 bp were analyzed. Sequence-based identifications were defined by percent identity: species, ≥99%; genus, 93 to 99%; and inconclusive, ≤93%. Molds were classified as fungi often associated with clinical disease (potential pathogens), emerging pathogens with more than three cases reported (emerging pathogens), or plant/soil-associated fungi with no or few published cases of human disease. Sequence information was independently analyzed by the Mycotic Diseases Branch of the Centers for Disease Control and Prevention (CDC) specifically to confirm microorganism identification.

The number of NSM reported was 215, which comprised 3.27% of the total number of fungal isolates identified at ARUP in 2005. A representative subset of 50 isolates reported as NSM (23%) was randomly selected for gene sequencing. The sources of these isolates were mostly respiratory (38 isolates) or skin, hair, and nails (11 isolates), with the source for 1 isolate not provided (Table 1).


View this table:
[in this window]
[in a new window]

  		TABLE 1. Identification of 48 nonsporulating molds by ITS sequencing

Forty-eight of the isolates had ITS sequence and match lengths of ≥400 bp, with an average sequence length of 572.3 ± 74.9 bp and an average match length of 560.3 ± 86.5 bp. The two isolates with sequence lengths of <400 bp were not included in the analysis. For the 48 sequences, gene sequencing identified 44 (92%) to genus level and 38 (79%) to species level, with 4 (8%) being inconclusive.

Sixteen isolates had reference sequences that shared ≥98% identity for more than one species, involving 12 genera. As a representative example, two isolates identified as being in the Pestalotiopsis genus had 10 and 20 reference sequences sharing ≥98% identity with multiple, different species, respectively. Phylogenetic tree construction for Pestaloptiopsis spp. also demonstrated a high degree of interspecies similarity and an absence of well-characterized strains within this genus. Similar results were found for 11 other genera.

Eight NSM were classified as fungi with pathogenic potential; these were Trichophyton verrucosum, Ajellomyces capsulatus (anamorph Histoplasma capsulatum), Aureobasidium pullulans, Exophiala dermatitidis, Exophiala jeanselmei, Fusarium sp., Lewia infectoria (anamorph Alternaria infectoria), and Phialophora sp. Eight NSM were classified as potential emerging pathogens: Botryosphaeria rhodina (anamorph Lasiodiplodia theobromae) (one isolate), Coniothyrium sp. (one isolate), Coprinus sp. (one isolate), and Schizophyllum commune (five isolates). Thirty-two isolates (66.7%) were identified as plant- and soil-associated fungi, mostly as filamentous basidomycetes.

Independent analysis of the NSM sequences by the CDC using the GenBank database correlated with our identifications. All eight potential pathogens were identified by the CDC, as were the five isolates identified as Schizophyllum commune, an emerging pathogen. Six additional fungi were identified to the genus or species level by the CDC method. For the remaining 29 isolates, the CDC reported them as filamentous basidomycetes (26 isolates) or coelomycetes (3 isolates) without further identification, which corroborated our classifications.

Molds are ubiquitous organisms in the environment and often transiently colonize the respiratory, integument, and gastrointestinal systems of healthy hosts. Traditionally, NSM recovered in the laboratory have been dismissed as insignificant environmental organisms without further testing. Additionally, for those laboratories that attempt to augment sporulation specifically for identification, the process can require up to 3 weeks of incubation and often is without success. To date, sequencing of NSM has been limited to case reports. To our knowledge, this study is the first to systematically evaluate a large number of NSM clinical isolates with ITS sequencing for further species identification. With sequencing the ITS 1 and ITS 2 regions, we identified the majority of NSM that could not be identified by conventional mycological methods and classified over one-third of these molds as well-recognized or emerging pathogens with potential for invasive disease in the appropriate clinical setting. As a national reference laboratory, we were unable to obtain clinical histories for these patients, but we presume that for the majority of these NSM, clinicians felt that the isolates had clinical relevance and referred them to our laboratory for fungal identification. We acknowledge that the classification of fungal pathogenicity with clinical relevance was difficult in the absence of patient data, but we based our classifications on standard practices and the current literature (1-3, 6-11, 13, 14). For example, ITS sequencing identified Histoplasma capsulatum (from bronchoalveolar lavage [BAL]), and although clinical correlation was not possible, the significance of this pathogen is well recognized. Similarly, we identified pathogens such as Schizophyllum commune (3, 10), Coniothyrium (6, 7), Coprinus (8, 13), and Botrysphaeria rhodina (1, 14), which can be considered emerging pathogens capable of causing disease when there is histopathological or other corroborating evidence. For many isolates identified by ITS sequencing, we classified them as environmental fungi because these microorganisms are commonly encountered in the clinical laboratory and usually have no clinical importance in healthy subjects (12). Yet, for immunocompromised hosts, the pathogenicity of such environmental fungi has not been well defined, and the capacity to characterize these organisms by ITS sequencing may prove useful when there is a high index of suspicion that the environmental NSM is a putative pathogen.

The taxonomy of many fungi is evolving, and names of organisms may change rapidly, while obsolete nomenclature may exist in databases; this may contribute to the results that we and others have observed in fungal identification using ITS sequences (4, 5). In attempts to minimize the risk for misidentification (2), we specifically selected a conservative match length of ≥400 bp and a 93% identity cutoff for identification to the genus level. The 93% cutoff was empirically determined to allow identification to the genus level of additional plant/soil-associated fungi. Despite these criteria, we found some clinical isolates sharing a high percent identity for multiple species, which suggests inadequate variation in the ITS regions and thereby prevention of species discrimination. When definitive fungal identification is clinically indicated, additional targets may be necessary to identify certain genera and species (5, 9). Four NSM were not conclusively identified by ITS sequencing in our study; these may represent novel species that do not have representative ITS reference sequences in GenBank.

In summary, ITS sequencing provides a fast alternative to conventional identification for nonsporulating molds. For specific specimen sources (e.g., tissue or BAL) and in the appropriate clinical setting, sequencing the ITS region for nonsporulating molds that cannot be conclusively characterized by conventional means could serve as a valuable tool to identify clinically relevant pathogens and enable the timely initiation of appropriate antifungal treatment.


arrow
ACKNOWLEDGMENTS
 
We thank Dewey Hansen and the staff of the ARUP Mycology Laboratory for technical support. We thank Sam Page and Wei Tang for sequencing and technical advice for this project.

Support for this study was provided by the ARUP Institute for Clinical and Experimental Pathology, an enterprise of the University of Utah and its Department of Pathology.

The findings and conclusions in this article are those of the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention.

We have no conflict of interest regarding the software, products, or concepts used in this study.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: ARUP Laboratories, 500 Chipeta Way, Salt Lake City, UT 84108. Phone: (801) 583-2787, ext. 3223. Fax: (801) 584-5109. E-mail: june.pounder{at}aruplab.com. Back

{triangledown} Published ahead of print on 29 November 2006. Back


arrow
REFERENCES
 
    1
  1. Borderie, V. M., T. M. Bourcier, J.-L. P. Poirot, M. Baudrimont, P. P. de Saint-Maur, and L. Larouche. 1997. Endophthalmitis after Lasiodiplodia theobromae corneal abscess. Graefe's Arch. Clin. Exp. Opthalmol. 235:259-261.[CrossRef][Medline]
    2. 2
  2. Brandt, M. E., D. Gaunt, N. Iqbal, S. McClinton, S. Hambleton, and L. Sigler. 2005. False-positive Histoplasma capsulatum Gen-Probe chemiluminescent test result caused by a Chrysosporium species. J. Clin. Microbiol. 43:1456-1458.[Abstract/Free Full Text]
    3. 3
  3. Buzina, W., D. Lang-Loidolt, H. Braun, K. Freudenschuss, and H. Stammberger. 2001. Development of molecular methods for identification of Schizophyllum commune from clinical samples. J. Clin. Microbiol. 39:2391-2396.[Abstract/Free Full Text]
    4. 4
  4. Guarro, J., J. Gene, and A. M. Stchigel. 1999. Developments in fungal taxonomy. Clin. Microbiol. Rev. 12:454-500.[Abstract/Free Full Text]
    5. 5
  5. Iwen, P. C., S. H. Hinrichs, and M. E. Rupp. 2002. Utilization of the internal transcribed spacer regions as molecular targets to detect and identify human fungal pathogens. Med. Mycol. 40:87-109.[Medline]
    6. 6
  6. Kiehn, T. E., B. Polsky, E. Punithalingam, F. Edwards, A. E. Brown, and D. Armstong. 1987. Liver infection caused by Coniothyrium fuckelii in a patient with acute myelogenous leukemia. J. Clin. Microbiol. 25:2410-2412.[Abstract/Free Full Text]
    7. 7
  7. Miele, P. S., C. S. Levy, M. A. Smith, E. M. Dugan, R. H. Cooke, J. A. Light, and D. R. Lucey. 2002. Primary cutaneous fungal infections in solid organ transplantation: a case study. Am. J. Transplant. 2:678-683.[CrossRef][Medline]
    8. 8
  8. Nenoff, P., T. Freidrich, H. Schwenke, M. Mierzwa, L. C. Horn, and U. F. Haustein. 1997. Rare fatal simultaneous mould infection of the lung caused by Aspergillus flavus and the basidiomycete Coprinus sp. in a leukemic patient. J. Med. Vet. Mycol. 35:65-69.[Medline]
    9. 9
  9. Rakeman, J. L, U. Bui, K. La Fe, Y.-C. Chen, R. J. Honeycutt, and B. T. Cookson. 2005. Multilocus DNA sequence comparisons rapidly identify pathogenic molds. J. Clin. Microbiol. 43:3324-3333.[Abstract/Free Full Text]
    10. 10
  10. Rihs, J. D., A. A. Padhe, and C. B. Good. 1996. Brain abscess caused by Schizophyllum commune: an emerging basidiomycete pathogen. J. Clin. Microbiol. 34:1628-1632.[Abstract]
    11. 11
  11. Schwarz, P., S. Bretagne, J.-C. Gantier, D. Garcia-Hermoso, O. Lortholary, F. Dromer, and E. Dannaoui. 2006. Molecular identification of zygomycetes from culture and experimentally infected tissues. J. Clin. Microbiol. 44:340-349.[Abstract/Free Full Text]
    12. 12
  12. Sigler, L., and S. P. Abbott. 1997. Characterizing and conserving diversity of filamentous basidiomycetes from human sources. Microbiol. Cult. Coll. 13:21-27.
    13. 13
  13. Surmont, I., F. Van Aelst, J. Verbanck, and G. S. De Hoog. 2002. A pulmonary infection caused by Coprinus cinereus (Hormographiella aspergillata) diagnosed after a neutropenic episode. Med. Mycol. 40:217-219.[Medline]
    14. 14
  14. Thomas, P. A. 2003. Current perspectives on ophthalmic mycoses. Clin. Microbiol. Rev. 16:730-797.[Abstract/Free Full Text]
    15. 15
  15. White, T. J., T. Bruns, S. Lee, and J. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, p. 315-322. In M. A. Innis, D. H. Gelfand, J. J. Snisky, and T. J. White (ed.), PCR protocols: a guide to methods and applications. Academic Press, San Diego, CA.

Journal of Clinical Microbiology, February 2007, p. 568-571, Vol. 45, No. 2
0095-1137/07/$08.00+0     doi:10.1128/JCM.01684-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Brandt, M. E., Gade, L., McCloskey, C. B., Balajee, S. A. (2009). Atypical Aspergillus flavus Isolates Associated with Chronic Azole Therapy. J. Clin. Microbiol. 47: 3372-3375 [Abstract] [Full Text]  
  • Balajee, S. A., Tay, S. T., Lasker, B. A., Hurst, S. F., Rooney, A. P. (2007). Characterization of a Novel Gene for Strain Typing Reveals Substructuring of Aspergillus fumigatus across North America. Eukaryot Cell 6: 1392-1399 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pounder, J. I.
Right arrow Articles by Petti, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pounder, J. I.
Right arrow Articles by Petti, C. A.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»