Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Monk, A. B. Articles by Archer, G. L. Search for Related Content PubMed PubMed Citation Articles by Monk, A. B. Articles by Archer, G. L.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, March 2007, p. 730-735, Vol. 45, No. 3
0095-1137/07/$08.00+0     doi:10.1128/JCM.02317-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Use of Outer Surface Protein Repeat Regions for Improved Genotyping of Staphylococcus epidermidis

Alastair B. Monk and Gordon L. Archer^*

Division of Infectious Diseases, Department of Internal Medicine, Virginia Commonwealth University School of Medicine, Richmond, Virginia 23298

Received 15 November 2006/ Returned for modification 11 December 2006/ Accepted 19 December 2006

Top Abstract Introduction Materials and Methods Results Discussion References

 
Staphylococcus epidermidis is an important nosocomial pathogen, but little is known of its epidemiology. Accurate, reproducible typing systems would greatly improve epidemiologic investigations of S. epidermidis. The sequence-based typing technique most recently evaluated, multilocus sequence typing (MLST), often lacks discrimination and can be expensive. PCR and sequence-based analyses of the serine-aspartate repeat region of sdrG (Fbe) and the repeat region of the accumulation-associated protein gene (aap) were evaluated for the ability to discriminate among previously well-characterized S. epidermidis clinical isolates. Forty-eight strains were investigated, with sdrG found in 100% and aap found in 79% of all strains tested. Both genes demonstrated PCR product size and nucleotide sequence variation. Each system by itself gave an index of discrimination similar in value to that of MLST (0.924 and 0.953 compared to 0.96), but discrimination was further improved when combinations of the three systems were used. We conclude that typing systems using amino acid and nucleotide repeat regions of the S. epidermidis surface proteins SdrG and Aap show promise as typing tools and should be investigated using a larger panel of clinically relevant isolates.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Staphylococcus epidermidis is one of the most important causes of nosocomial bacteremia (26). S. epidermidis is responsible for 50 to 70% of catheter-related and other foreign body infections (26). The prerequisite for S. epidermidis foreign body infections is biofilm formation, mediated initially by a range of outer surface proteins, including staphylococcal surface proteins (SSP1 and -2), autolysin proteins (AtlE), and an accumulation-associated protein (Aap) (26). Biofilm formation can also occur via direct interaction between host extracellular matrix proteins, such as fibrinogen, fibronectin, and thrombospondin, and S. epidermidis outer surface proteins, such as fibrinogen binding protein (Fbe). Fbe (sdrG) has previously been shown to promote adhesion to fibrinogen (3, 6) and is a member of a family of serine-aspartate repeat proteins expressed by S. epidermidis (14). There are three members of the cell surface-associated serine-aspartate family of proteins in S. epidermidis, namely, SdrF, SdrG (Fbe), and SdrH, and they are all characterized by the distinctive serine-aspartate dipeptide (SD) repeats (14). SdrG (Fbe) is a 93.7-kDa protein with a 50-residue signal sequence proximal to the amino terminus and serine-aspartate repeats proximal to the LPXTG motif at the carboxy terminus (2, 14). Accumulation-associated protein (Aap) has previously been shown to be associated with biofilm formation and adherence to cells (19, 22). Aap has also been shown to be a poor marker of whether an S. epidermidis isolate is commensal or invasive (20, 25), although it is considered a virulence factor (20). Aap is a surface-exposed outer surface protein of 140 kDa composed of an N-terminal domain of short, 16-amino-acid (aa) repeats, 13 repeats of 128 aa, and 19 repeats of 6 aa, with an LPXTG and transmembrane domain at the C terminus (2).

Little is known of the epidemiology of S. epidermidis in the health care or carriage setting, and the basis for S. epidermidis epidemiology has mostly been pulsed-field gel electrophoresis (PFGE) analysis (12, 23). PFGE has been shown to be highly discriminatory but is labor-intensive and costly, and problems exist with standardization for interlaboratory reproducibility (15). Other typing systems in current use for S. epidermidis include randomly amplified polymorphic DNA analysis (13), multilocus variable number of tandem repeat analysis (8), and amplified fragment length polymorphism analysis (21). All of these systems are also gel-based band typing systems, and problems exist with the reproducibility of patterns between gels and labs. Multilocus sequencing typing (MLST) is a well-established method for discriminating among bacterial isolates that utilizes the DNA sequences of internal fragments of so-called housekeeping genes in order to assign strains to sequence types (STs) (28). This system is highly reproducible since it is based on sequence data, but it may not distinguish among individual isolates. Two different MLST systems have previously been reported for S. epidermidis (27, 28), but the recent publication of a condensed MLST system combining elements of all three systems to give the most discriminatory scheme is the one that was used in this investigation. For Staphylococcus aureus, the addition of a typing system based on the sequence of the repeat region in surface protein A (encoded by spa) is also reproducible and adds a greater level of discrimination to MLST (17).

In the present work, the nucleotide serine-aspartate repeat regions of sdrG (Fbe) and the nucleotides of aap encoding the six-amino-acid repeat region were amplified via PCR and sequenced from a wide range of previously well-characterized isolates of S. epidermidis. The repeat regions were analyzed to see if they could provide increased discrimination to MLST and be used to independently type S. epidermidis. We chose to compare only sequence-based rather than gel-based (e.g., PFGE or randomly amplified polymorphic DNA analysis) typing systems because we felt that they were more reproducible and could more easily be applied for general use. It has also been shown that MLST is equally as discriminatory as PFGE for the closely related species S. aureus (16).

Top Abstract Introduction Materials and Methods Results Discussion References

 
Bacterial strains and media. A selection of 48 isolates previously well characterized via SCCmec typing and MLST (28) were used to assess whether sdrG (Fbe) repeats and aap repeats can discriminate among isolates of S. epidermidis. The 48 isolates were composed of 30 isolates collected from the blood of patients with prosthetic valve endocarditis (PVE) and 17 isolates from the blood of patients without PVE collected as part of the Surveillance and Control of Pathogens of Epidemiological Importance (SCOPE) study (4). A total of 28 PVE isolates were methicillin resistant, and 2 were methicillin susceptible, while 10 of the SCOPE isolates were methicillin resistant and 7 were methicillin susceptible. The final isolate (RP62A28) was an isolate (RP62A) repeatedly passaged for 28 days in order to test the in vitro stability of the repeat regions. All strains were grown in brain heart infusion broth or agar (Becton Dickinson, Sparks, MD) at 37°C, with shaking at 220 rpm.

MLST typing. Genomic DNA was extracted using a QIAGEN DNA miniprep kit (QIAGEN, Hilden, Germany). Seven genes were used for this MLST system, as recently described by Thomas et al. (24). Primers (24) were designed to amplify carbamate kinase (arcC), shikimate dehydrogenase (aroE), glutamyl-tRNA reductase (gtr), pyrimidine biosynthesis (pyr), DNA mismatch repair protein (mutS), triosephosphate isomerase (tpi), and acetyl coenzyme A acetyltransferase (yqiL) genes. PCR amplification of the genes was performed in 50-µl reaction mixes composed of 1 µl of template DNA, 1 µl of each primer set (100 pmol of each primer), 18 µl of sterile distilled water, and 30 µl of QIAGEN PCR Supermix (QIAGEN, Hilden, Germany). The thermocycler conditions were as follows: 95°C for 2 min and then 35 cycles of 95°C for 30 seconds, 55°C for 30 seconds, and extension at 72°C for 2 min for all genes. The genes were visualized on a 1.5% acrylamide gel stained with ethidium bromide. All PCRs were cleaned up using a QiaQuick PCR purification kit (QIAGEN, Valencia, CA). Nucleotide sequences were obtained for PCR products in both directions, using the same primer sets as those for amplification (at 10 pmol), with an annealing temperature of 55°C and with BigDye fluorescent terminators on an ABI Prism 3700 instrument. Contigs of sequence data were constructed using Vector NTI v7.1 (Invitrogen, Carlsbad, CA), using maximum stringency, and were edited manually. Alleles were assigned in comparison to the MLST website (http://www.mlst.net).

PCR amplification of repeat regions. Genomic DNA was extracted using a QIAGEN DNA miniprep kit (QIAGEN, Hilden, Germany). The size of the sdrG repeat region was established using PCR primers SDTYPING1F (5' CTCAGAAGGCAATTCTGTATGG 3') and SDTYPING1R (5' AACGCTCCTAAACCTGCAAA 3'), and the aap repeat region size was established using PCR primers AAPREPEATF (5' TCACTAAACAACCTGTTGACGAA 3') and AAPREPEATR (5' AATTGATTTTTATTATCTGTTGAATGC 3'). Both sets of primers were designed using the RP62A genome. Amplification was performed in 50-µl reaction mixes composed of 1 µl of template DNA, 1 µl of each primer (100 pmol of each), 18 µl of sterile distilled water, and 30 µl of QIAGEN PCR Supermix (QIAGEN, Hilden, Germany). The thermocycler conditions were as follows: 95°C for 2 min and then 35 cycles of 95°C for 30 seconds, 55°C for 30 seconds, and extension at 72°C for 2 min for both genes. The genes were visualized on a 1.5% acrylamide gel stained with ethidium bromide.

Repeat region sequencing. All PCRs were cleaned up using a QiaQuick PCR purification kit (QIAGEN, Valencia, CA). Nucleotide sequences were obtained for PCR products in both directions for sdrG, using SDTYPING1R and SDTYPING2F (5' CAACAACAACTGATGAAAATGGA 3'), and for aap, using AAPREPEATF and AAPREPEATR, using the primers at 10 pmol, an annealing temperature of 55°C, and BigDye fluorescent terminators, on an ABI Prism 3700 instrument. Contigs of sequence data were constructed using Vector NTI v7.1 (Invitrogen, Carlsbad, CA), using maximum stringency, and were edited manually. Once assembled, the nucleotide data were cross checked for PCR amplicon size.

Assignment of alleles and sequence types. The nucleotide coding regions for the SD repeat region of the sdrG gene product and the six-amino-acid repeat region of the aap gene product (Fig. 1) were used to discriminate among isolates. Initially, the described repeat regions of RP62A were used to assign alleles, as shown in Fig. 1, based upon differences in sequence and size. The nucleotide sequences of the repeat regions from the remaining isolates were then identified by comparison to RP62A, and individual 12-, 18-, or 21-base-pair repeats were used to generate a repeat region database. Any unique unidentified repeats were assigned a number, and the sequence of individual repeats or numbers described the ST for that isolate. The numbers were assigned in sequence as each differing repeat was encountered, beginning with RP62A. Thus, the RP62A sdrG repeat region had a pattern of 1-2-3-4-5-6-7-8-9, indicating that there were nine sets of 18- or 21-base-pair repeats in this region; this pattern described sequence type 1. Sequence type 2 became 1-10-2-11-7-4-2-12-8, and so on (Table 1). A similar system was followed for assigning repeat numbers to aap (Table 1). Lineages were assigned from the SD typing nucleotide data on the basis of global clustering via the use of Clustal W (1). The clustering grouped the repeat regions into subsets of sequence data that were arbitrarily defined as lineages on the basis of minor rearrangements and point mutations between the members of the lineage and major rearrangements and region differences between members of different lineages. Although the initial sequence types were assigned by visual inspection, a computer program assigned new repeat numbers and designated the sequence types for isolates typed later.

View larger version (58K): [in this window] [in a new window]

FIG. 1. Genes studied in this investigation. The genes are shown schematically, with the repeat regions of interest as well as primer binding sites. *, PCR and sequencing primer binding sites (arrows show an alternative sequencing primer for sdrG only); S, signal peptide; A, ligand binding domain; B, repeat region; SD, serine-aspartate repeats; W, cell wall spanning domain. Repeat regions are shown in bold italics. (Adapted from Microbiology [2] with permission of the publisher.)

View this table: [in this window] [in a new window]

TABLE 1. Examples of repeat regions for Aap STs and SD repeat STs in this investigation

Statistical analysis. Synonymous and nonsynonymous mutations and ratios were calculated using the Nei-Gojobori (Jukes-Cantor-corrected) method, with pairwise deletion handling of gaps; the standard error was determined using 1,000 bootstrap replicates. Z tests for neutrality of mutations as well as for synonymous and nonsynonymous mutations were all calculated using MEGA v3.1 (11). Discrimination of the typing systems was calculated using Simpson's index of diversity (7), which indicates the probability that two random isolates from a population will have different genotypes.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Isolate information. MLST divided the 48 strains into 16 STs, with the predominant STs being ST8 (n = 14) and ST27 (n = 7) and with ST2, -3, and -20 each composed of three isolates. ST5 and -7 were composed of two isolates each, and ST22, -28, -29, -59, -61, -62, and -99 were all composed of single isolates, as shown in Table 2. SD typing divided the isolates into 27 STs, and aap typing divided the isolates into 35 STs. SD ST5 was the predominant SD ST (n = 9), with ST1 (n = 3) and ST7 (n = 2) being the next most prevalent sequence types. All other sequence types were composed of single isolates only. Aap ST35 (n = 9) was the predominant Aap ST, and ST15 (n = 4) was the next most predominant ST, with all other STs composed of single isolates only. SD typing also divided the isolates into five major lineages, with lineages 3 and 5 sharing the majority of isolates, as shown in Table 2. Only two isolates shared an identical MLST, SD typing, and Aap typing repeat, and these were genotypically MLST ST8, SD ST5, and Aap ST35.

View this table: [in this window] [in a new window]

TABLE 2. MLST, SCCmec, SD repeat, and aap typing STs for each isolate in this investigation

sdrG SD repeat types, sizes, and lineages. sdrG was chosen as the initial gene to be analyzed, as other single genes with sufficient repeat regions did not display as much variation (A. Monk, unpublished data). Serine-aspartate repeats have previously been shown to allow a high degree of discrimination in S. aureus (10). Initial surveys revealed the largest amount of size variation in sdrG PCR amplicons, and the gene was present in all strains surveyed (14). There were three differently sized PCR amplicons of the SD repeat region from the 48 strains analyzed (200 bp, 4 to 500 bp, and 8 to 900 bp), and there was 100% concordance between the size of the PCR fragment and the number of repeat cassettes. The DNA sequence revealed 69 alleles of the repeat cassette, composed of 1 21-bp, 4 12-bp, and 64 different 18-bp repeats. These combined to give 27 different STs and seven lineages, as shown in Table 1. The SD typing system had a Simpson's index of discrimination of 0.924, which is less than the MLST value of 0.96, as shown in Table 3. However, SD typing managed to subdivide identical MLST types. Forty-one isolates in this investigation fell into only nine MLST types (STs 2, 3, 5, 7, 8, 12, 18, 20, and 27). When SD typing and MLST were used in conjunction, the 41 isolates fell into 32 different STs overall, and the index of discrimination increased to 0.992, as shown in Table 3. In addition, identical STs of the SD typing system are present in multiple different MLST backgrounds, which suggests that there may have been genetic exchange and recombination of sdrG between different genetic backgrounds of S. epidermidis.

View this table: [in this window] [in a new window]

TABLE 3. Simpson's indexes of diversity for typing systems considered in this investigation

aap repeats, sizes, and types. The aap repeat region was detected via PCR in 38 of the 48 strains in this study (79%). aap was used in this investigation as an additional typing system because even though it was not present in all isolates, the gene exhibited high variability in both PCR and sequencing assays. In addition, aap has some similarity to spa of S. aureus, a proven epidemiological marker. There were three differently sized PCR amplicons of the aap repeat region (data not shown), with 100% concordance between the size of the PCR fragment and the number of repeat cassettes. Thirty-six alleles of the aap repeat cassette were composed of 38 different 18-base-pair repeats and combined to give 35 different STs, as shown in Table 1. The aap typing system had a Simpson's index of discrimination of 0.954, which is almost equal to that of the MLST system alone (0.96). When combined with MLST, aap typing increased the index of diversity to 0.997 (Table 3), with the 41 isolates previously mentioned being subdivided into 38 different STs.

Evolutionary pressure on both repeat regions. The SD repeat region cassettes always started with TC, and the overall repeat was structured as follows: TC(X₁)(X₂)(X₃)(X₄)(X₅)(X₁)(X₁)(X₆)(X₃)(X₇)(X₈)(X₂)(X₁)(X₃)(X₂)(X₄), where X₁ is A, G, C, or T, X₂ is A, G, or C, X₃ is A or G, X₄ is T or C, X₅ is T or A, X₆ is T or G, X₇ is T, C, or A, and X₈ is A or T. The SD repeat region had a synonymous/nonsynonymous mutation (dS/dN) ratio of 4.2, indicating that the SD repeat region is under the influence of purifying selection. A result of <1 would have indicated that the region is under the influence of positive selection, 1 would indicate no selection at all, and a result of >1 indicates purifying selection. Purifying selection is thought to have occurred when existing amino acids are selected to stay the same by pressure against nonsynonymous mutations which would change an amino acid. The dS value was 0.89 (standard error, 0.17), and the dN value was 0.24 (standard error, 0.17). A Z test for purifying selection was highly significant (P = 0.00014). While mutation would appear to be the main source of variation within the SD repeat alleles, slip-strand mispairing has commonly been observed in clfB (an SD gene with similarity to sdrG) and spa, which have repeat regions used for typing of S. aureus (9, 10).

The 18-bp repeat of aap had a highly conserved repeat pattern of CC(X₁)(X₂)(X₃)(X₄)(X₅)(X₆)(X₆)(X₆)(X₇)(X₁)(X₄)(X₆)(X₃)(X₄)(X₆)(X₄), where X₁ is A or T, X₂ is G or A, X₃ is C, T, A, or G, X₄ is G, A, or T, X₅ is G, C, or A, X₆ is A, T, or C, and X₇ is C or A, and had a dS/dN ratio of 0.24, indicating that the repeat region is under the influence of positive selection. A Z test for positive selection was performed and was also significant (P = 0.00031). Both repeat regions also appeared to be stable, since in vitro passaging of RP62A for 28 days on brain heart infusion agar did not change the profile of either repeat.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Standardized, highly discriminatory, reproducible typing systems are needed for distinguishing among S. epidermidis isolates because of their importance as nosocomial pathogens. Highly variable genes encoding outer surface proteins that interact with the environment or the host have been shown to be as informative for typing as housekeeping genes for the closely related species S. aureus (18). In this paper, we describe two new nucleotide sequence-based typing systems that utilize only single gene products and have high discrimination (equal to or slightly less than that of MLST). The two gene systems described in this paper also have the ability to increase the resolution of MLST data, as these systems could be used to further subdivide identical MLST STs. The genes chosen have regions of repeated sequence, and both the sequence of the repeats and the number of repeats vary among isolates. However, the repeat regions appear to be stable when isolates are passaged in vitro, making these regions good candidates for epidemiological typing markers.

We have shown possible evidence of recombination in the SD repeat region of sdrG, with identical SD types being found in multiple previously defined STs and lineages. The recombination noted in the SD repeats of sdrG explains the lower discrimination for this typing system than that for MLST and Aap typing due to shared alleles, with STs present in multiple backgrounds. It also suggests that S. epidermidis undergoes genome diversification by interstrain genetic exchange and recombination. This is supported by recent work where metabolic genes called "housekeeping" genes in the MLST system have been shown to be four times more likely to diversify via recombination than by mutation in S. epidermidis (M. C. Enright, personal communication). Recombination can mask phylogenetic relationships, as previously shown (5). The recombination discovered in sdrG of S. epidermidis is similar to that noted in the SD repeat region of clfB from the closely related organism S. aureus (10).

The two gene systems studied in this paper are under different selection pressures. The SD typing region is under strong purifying selection pressure, suggesting that the characteristic SD amino acid repeats are under pressure to stay the same, producing a stable evolutionary marker, although it is not as discriminatory as Aap or the targets of MLST. In contrast, the aap region is under positive selection, perhaps due to its previously noted function as a virulence factor. The high rate of variation at this gene locus is an important characteristic of genes that are useful as epidemiological markers. We have shown that the aap gene can be used as an independent epidemiological marker, with equal discrimination to MLST (0.954 and 0.96, respectively). However, aap is not present in every strain, and another study found the gene to be present in 88% of colonizing and 68% of invasive isolates (20), similar to the value found in our study (79%). Yet the presence or absence of aap by itself may be a genotypic marker with both typing and clinical implications. This possibility requires additional investigation with a larger set of isolates that have been characterized clinically. We have also demonstrated that either single-gene epidemiological marker can impart higher discrimination to the MLST system (index of discrimination, 0.994 for MLST plus SD typing, 0.996 for MLST plus aap typing, and 0.96 for MLST alone), and both together are also better than MLST alone (0.994 for SD plus aap typing versus 0.96 for MLST). Thus, the use of single-gene versus multiple-gene (e.g., MLST) typing systems should be driven by cost (single genes would be cheaper), the need for more discrimination (localized epidemiology for the more discriminatory gene repeat systems, as opposed to large-scale evolutionary studies for MLST), and time. We suggest using aap typing as a simple, inexpensive epidemiological genotyping method while using MLST in conjunction with SD and aap typing for long-term evolutionary studies.

 
This work was supported by grant 5R01AI35705-13 from the National Institute of Allergy and Infectious Diseases.

 
* Corresponding author. Mailing address: Virginia Commonwealth University School of Medicine, Sanger Hall, Room 1-018, 1101 East Marshall St., Richmond, VA 23298. Phone: (804) 828-0673. Fax: (804) 828-5022. E-mail: garcher{at}vcu.edu.

Published ahead of print on 3 January 2007.

Top Abstract Introduction Materials and Methods Results Discussion References

 

1
1. Aiyar, A. 2000. The use of CLUSTAL W and CLUSTAL X for multiple sequence alignment. Methods Mol. Biol. 132:221-241.[Medline]
2
2. Bowden, M. G., W. Chen, J. Singvall, Y. Xu, S. J. Peacock, V. Valtulina, P. Speziale, and M. Hook. 2005. Identification and preliminary characterization of cell-wall-anchored proteins of Staphylococcus epidermidis. Microbiology 151:1453-1464.[Abstract/Free Full Text]
3
3. Davis, S. L., S. Gurusiddappa, K. W. McCrea, S. Perkins, and M. Hook. 2001. SdrG, a fibrinogen-binding bacterial adhesin of the microbial surface components recognizing adhesive matrix molecules subfamily from Staphylococcus epidermidis, targets the thrombin cleavage site in the Bbeta chain. J. Biol. Chem. 276:27799-27805.[Abstract/Free Full Text]
4
4. Edmond, M. B., S. E. Wallace, D. K. McClish, M. A. Pfaller, R. N. Jones, and R. P. Wenzel. 1999. Nosocomial bloodstream infections in United States hospitals: a three-year analysis. Clin. Infect. Dis. 29:239-244.[Medline]
5
5. Feil, E. J., E. C. Holmes, D. E. Bessen, M. S. Chan, N. P. Day, M. C. Enright, R. Goldstein, D. W. Hood, A. Kalia, C. E. Moore, J. Zhou, and B. G. Spratt. 2001. Recombination within natural populations of pathogenic bacteria: short-term empirical estimates and long-term phylogenetic consequences. Proc. Natl. Acad. Sci. USA 98:182-187.[Abstract/Free Full Text]
6
6. Hartford, O., L. O'Brien, K. Schofield, J. Wells, and T. J. Foster. 2001. The Fbe (SdrG) protein of Staphylococcus epidermidis HB promotes bacterial adherence to fibrinogen. Microbiology 147:2545-2552.[Abstract/Free Full Text]
7
7. Hunter, P. R., and M. A. Gaston. 1988. Numerical index of the discriminatory ability of typing systems: an application of Simpson's index of diversity. J. Clin. Microbiol. 26:2465-2466.[Abstract/Free Full Text]
8
8. Johansson, A., S. Koskiniemi, P. Gottfridsson, J. Wistrom, and T. Monsen. 2006. Multiple-locus variable-number tandem repeat analysis for typing of Staphylococcus epidermidis. J. Clin. Microbiol. 44:260-265.[Abstract/Free Full Text]
9
9. Koreen, L., S. V. Ramaswamy, E. A. Graviss, S. Naidich, J. M. Musser, and B. N. Kreiswirth. 2004. spa typing method for discriminating among Staphylococcus aureus isolates: implications for use of a single marker to detect genetic micro- and macrovariation. J. Clin. Microbiol. 42:792-799.[Abstract/Free Full Text]
10
10. Koreen, L., S. V. Ramaswamy, S. Naidich, I. V. Koreen, G. R. Graff, E. A. Graviss, and B. N. Kreiswirth. 2005. Comparative sequencing of the serine-aspartate repeat-encoding region of the clumping factor B gene (clfB) for resolution within clonal groups of Staphylococcus aureus. J. Clin. Microbiol. 43:3985-3994.[Abstract/Free Full Text]
11
11. Kumar, S., K. Tamura, and M. Nei. 2004. MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief. Bioinform. 5:150-163.[Abstract/Free Full Text]
12
12. Linhardt, F., W. Ziebuhr, P. Meyer, W. Witte, and J. Hacker. 1992. Pulsed-field gel electrophoresis of genomic restriction fragments as a tool for the epidemiological analysis of Staphylococcus aureus and coagulase-negative staphylococci. FEMS Microbiol. Lett. 74:181-185.[Medline]
13
13. Marquet-Van Der Mee, N., S. Mallet, J. Loulergue, and A. Audurier. 1995. Typing of Staphylococcus epidermidis strains by random amplification of polymorphic DNA. FEMS Microbiol. Lett. 128:39-44.[CrossRef][Medline]
14
14. McCrea, K. W., O. Hartford, S. Davis, D. N. Eidhin, G. Lina, P. Speziale, T. J. Foster, and M. Hook. 2000. The serine-aspartate repeat (Sdr) protein family in Staphylococcus epidermidis. Microbiology 146:1535-1546.[Abstract/Free Full Text]
15
15. Murchan, S., M. E. Kaufmann, A. Deplano, R. de Ryck, M. Struelens, C. E. Zinn, V. Fussing, S. Salmenlinna, J. Vuopio-Varkila, N. El Solh, C. Cuny, W. Witte, P. T. Tassios, N. Legakis, W. van Leeuwen, A. van Belkum, A. Vindel, I. Laconcha, J. Garaizar, S. Haeggman, B. Olsson-Liljequist, U. Ransjo, G. Coombes, and B. Cookson. 2003. Harmonization of pulsed-field gel electrophoresis protocols for epidemiological typing of strains of methicillin-resistant Staphylococcus aureus: a single approach developed by consensus in 10 European laboratories and its application for tracing the spread of related strains. J. Clin. Microbiol. 41:1574-1585.[Abstract/Free Full Text]
16
16. Peacock, S. J., G. D. de Silva, A. Justice, A. Cowland, C. E. Moore, C. G. Winearls, and N. P. Day. 2002. Comparison of multilocus sequence typing and pulsed-field gel electrophoresis as tools for typing Staphylococcus aureus isolates in a microepidemiological setting. J. Clin. Microbiol. 40:3764-3770.[Abstract/Free Full Text]
17
17. Robinson, D. A., and M. C. Enright. 2003. Evolutionary models of the emergence of methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 47:3926-3934.[Abstract/Free Full Text]
18
18. Robinson, D. A., A. B. Monk, J. E. Cooper, E. J. Feil, and M. C. Enright. 2005. Evolutionary genetics of the accessory gene regulator (agr) locus in Staphylococcus aureus. J. Bacteriol. 187:8312-8321.[Abstract/Free Full Text]
19
19. Rohde, H., C. Burdelski, K. Bartscht, M. Hussain, F. Buck, M. A. Horstkotte, J. K. Knobloch, C. Heilmann, M. Herrmann, and D. Mack. 2005. Induction of Staphylococcus epidermidis biofilm formation via proteolytic processing of the accumulation-associated protein by staphylococcal and host proteases. Mol. Microbiol. 55:1883-1895.[CrossRef][Medline]
20
20. Rohde, H., M. Kalitzky, N. Kroger, S. Scherpe, M. A. Horstkotte, J. K. Knobloch, A. R. Zander, and D. Mack. 2004. Detection of virulence-associated genes not useful for discriminating between invasive and commensal Staphylococcus epidermidis strains from a bone marrow transplant unit. J. Clin. Microbiol. 42:5614-5619.[Abstract/Free Full Text]
21
21. Sloos, J. H., P. Janssen, C. P. van Boven, and L. Dijkshoorn. 1998. AFLP typing of Staphylococcus epidermidis in multiple sequential blood cultures. Res. Microbiol. 149:221-228.[Medline]
22
22. Sun, D., M. A. Accavitti, and J. D. Bryers. 2005. Inhibition of biofilm formation by monoclonal antibodies against Staphylococcus epidermidis RP62A accumulation-associated protein. Clin. Diagn. Lab. Immunol. 12:93-100.
23
23. Tenover, F. C., R. D. Arbeit, R. V. Goering, P. A. Mickelsen, B. E. Murray, D. H. Persing, and B. Swaminathan. 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J. Clin. Microbiol. 33:2233-2239.[Medline]
24
24. Thomas, J. C., M. R. Vargas, M. Miragaia, S. J. Peacock, G. L. Archer, and M. C. Enright. 6 December 2006. An improved multilocus sequence typing scheme for Staphylococcus epidermidis. J. Clin. Microbiol. doi:10.1128/JCM. 01934-06.
25
25. Vandecasteele, S. J., W. E. Peetermans, R. Merckx, B. J. Rijnders, and J. Van Eldere. 2003. Reliability of the ica, aap and atlE genes in the discrimination between invasive, colonizing and contaminant Staphylococcus epidermidis isolates in the diagnosis of catheter-related infections. Clin. Microbiol. Infect. 9:114-119.[CrossRef][Medline]
26
26. von Eiff, C., G. Peters, and C. Heilmann. 2002. Pathogenesis of infections due to coagulase-negative staphylococci. Lancet Infect. Dis. 2:677-685.[CrossRef][Medline]
27
27. Wang, X. M., L. Noble, B. N. Kreiswirth, W. Eisner, W. McClements, K. U. Jansen, and A. S. Anderson. 2003. Evaluation of a multilocus sequence typing system for Staphylococcus epidermidis. J. Med. Microbiol. 52:989-998.[Abstract/Free Full Text]
28
28. Wisplinghoff, H., A. E. Rosato, M. C. Enright, M. Noto, W. Craig, and G. L. Archer. 2003. Related clones containing SCCmec type IV predominate among clinically significant Staphylococcus epidermidis isolates. Antimicrob. Agents Chemother. 47:3574-3579.[Abstract/Free Full Text]

---

Journal of Clinical Microbiology, March 2007, p. 730-735, Vol. 45, No. 3
0095-1137/07/$08.00+0     doi:10.1128/JCM.02317-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• McLaws, F., Chopra, I., O'Neill, A. J. (2008). High prevalence of resistance to fusidic acid in clinical isolates of Staphylococcus epidermidis. J Antimicrob Chemother 61: 1040-1043 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Monk, A. B. Articles by Archer, G. L. Search for Related Content PubMed PubMed Citation Articles by Monk, A. B. Articles by Archer, G. L.