This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ward, K. N.
Right arrow Articles by Clark, D. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ward, K. N.
Right arrow Articles by Clark, D. A.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, April 2007, p. 1298-1304, Vol. 45, No. 4
0095-1137/07/$08.00+0     doi:10.1128/JCM.02115-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Human Herpesvirus 6 DNA Levels in Cerebrospinal Fluid Due to Primary Infection Differ from Those Due to Chromosomal Viral Integration and Have Implications for Diagnosis of Encephalitis{triangledown}

Katherine N. Ward,1* Hoe Nam Leong,2 Anton D. Thiruchelvam,1 Claire E. Atkinson,2 and Duncan A. Clark2,{dagger}

Centre for Virology, Division of Infection and Immunity, Royal Free and University College Medical School, UCL Campus, Windeyer Institute of Medical Sciences, 46 Cleveland Street, London W1T 4JF, United Kingdom,1 Centre for Virology, Division of Infection and Immunity, Royal Free and University College Medical School, Hampstead Campus, Rowland Hill Street, London NW3 2PF, United Kingdom2

Received 17 October 2006/ Returned for modification 11 December 2006/ Accepted 5 January 2007


arrow
ABSTRACT
 
The prevalence and concentration of human herpesvirus 6 (HHV-6) DNA in the cerebrospinal fluid (CSF) of the immunocompetent in primary infection was compared with that in viral chromosomal integration. Samples from 510 individuals with suspected encephalitis, 200 young children and 310 older children and/or adults, and 12 other patients were tested. HHV-6 DNA concentration (log10 copies/ml) was measured in CSF, serum, and whole blood using PCR. Serum HHV-6 immunoglobulin G antibody was measured by indirect immunofluorescence. Primary infection was defined by antibody seroconversion and/or a low concentration of HHV-6 DNA (<3.0 log10 copies/ml) in a seronegative serum. Chromosomal integration was defined by a high concentration of viral DNA in serum (≥3.5 log10 copies/ml) or whole blood (≥6.0 log10 copies/ml). The prevalences of CSF HHV-6 DNA in primary infection and chromosomal integration were 2.5% and 2.0%, respectively, in the young children (<2 years) and 0% and 1.3%, respectively, in the older children and/or adults. The mean concentration of CSF HHV-6 DNA in 9 children with primary infection (2.4 log10 copies/ml) was significantly lower than that of 21 patients with viral chromosomal integration (4.0 log10 copies/ml). Only HHV-6B DNA was found in primary infection, whereas in viral integration, 4 patients had HHV-6A and 17 patients HHV-6B. Apart from primary infection, chromosomal integration is the most likely cause of HHV-6 DNA in the CSF of the immunocompetent. Our results show that any diagnosis of HHV-6 encephalitis or other type of active central nervous system infection should not be made without first excluding chromosomal HHV-6 integration by measuring DNA load in CSF, serum, and/or whole blood.


arrow
INTRODUCTION
 
Not long after its discovery in 1986 (32), human herpesvirus 6 (HHV-6) was associated with neurological disease when primary infection was described in a liver transplant patient with grand mal fits (44). At that time, primary infection, although usually silent, was known sometimes to cause exanthem subitum (50). However, in the next decade, there were further reports of primary infection and neurological disease, especially in young immunocompetent children with fever and seizures (19, 23, 35, 43). Additionally, occasional cases of encephalitis were diagnosed in young children with primary infection (for a review, see reference 51). Most recently, primary HHV-6 infection has been shown to be an important cause of the neurological emergency of status epilepticus with fever in children up to 2 years old (41).

Primary HHV-6 infection almost invariably occurs in the first 2 years of life (19, 45, 52), but rare cases of encephalitis, presumed due to HHV-6 reactivation, have been reported in immunocompetent older children and adults (28). In the absence of primary infection, the key finding linking HHV-6 to these cases was the detection of viral DNA in cerebrospinal fluid (CSF) by PCR, leading to the assumption that HHV-6 was replicating in the central nervous system (CNS). However, this interpretation has been questioned in view of the phenomenon of HHV-6 chromosomal integration (8, 46).

HHV-6 is the only human herpesvirus found integrated into host chromosomes (10, 37, 38). The occasional individual with such integration is easily identifiable, since every leukocyte inevitably contains viral sequences and there are thus characteristically persistent high levels of HHV-6 DNA in both serum and whole blood (8, 46). Since normal CSF, i.e., in the absence of inflammation, contains a few leukocytes, it is only to be expected that, in cases of HHV-6 integration, viral DNA will be present in CSF even though there is no viral replication. This is in sharp contrast to the usual scenario in immunocompetent persons in whom, after primary infection, HHV-6 persists throughout life and is only found in the infrequent leukocyte (7), and hence, viral DNA is not normally found in CSF.

Thus, when assessing the significance of viral DNA in CSF and its relationship to neuropathogenesis, chromosomal HHV-6 integration must be distinguished from primary infection in young children and from putative virus reactivation in older individuals. In this context, it is also important to differentiate HHV-6 variant A (HHV-6A) from HHV-6 variant B (HHV-6B), as either virus may be chromosomally integrated (8, 46) but only HHV-6B is found in primary infection in young children (14). We now report on the prevalence and concentration of HHV-6A and B DNA in the CSF of immunocompetent patients with suspected encephalitis and compare the findings for primary infection with those for viral chromosomal integration. The implications for diagnosis of HHV-6 encephalitis are discussed.


arrow
MATERIALS AND METHODS
 
Patients. (i) Group 1, routine diagnosis patients. There were 510 immunocompetent patients of all ages with neurological illness whose serum and CSF samples had been referred between October 1998 and September 2003 for routine diagnosis of HHV-6 infection. This group includes children aged 2 months to 3 years reported to a British Isles-wide survey between October 1998 and September 2001 because of suspected encephalitis (41).

(ii) Group 2, referred HHV-6 patients. There were 12 immunocompetent patients found to have viral DNA in their CSF with presumed HHV-6 encephalitis. Samples of whole blood and/or serum and CSF from these patients had been sent to us for further investigation between October 1998 and September 2005.

The samples from both groups of patients had originated from all over the British Isles, and informed consent was obtained in the usual way by the referring clinician in accordance with good clinical practice.

Semiquantitative PCR for HHV-6. Nucleic acid (both RNA and DNA) was extracted from serum or CSF using the QIAmp RNA mini kit (QIAGEN Ltd., Crawley, United Kingdom) and the extract tested for HHV-6 DNA using a nested PCR (22). As previously described (47), the amount of viral DNA in positive specimens was estimated semiquantitatively by PCR using serial 10-fold dilutions. The result was expressed as log10 copies/ml. This method was used on samples up to 2003, after which it was superseded by the quantitative PCR described below.

Quantitative PCR for HHV-6. DNA was extracted from whole blood, serum, or CSF using the QIAmp DNA mini kit (QIAGEN Ltd., Crawley, United Kingdom). Five microliters of nucleic acid extract was tested for HHV-6 DNA. A TaqMan PCR was performed using an ABI 7700 sequence detector (Applied Biosystems). Amplification primers were U67F, 5'-GGCTAGAACGTATTTGCTGCAGA-3', and U67R, 5'-AATGTACGTCCCCGAAATGG-3', and the TaqMan probe was U67P, 5'-(FAM)CGTTTCGCGGACTCAAGATCAACAAGTT(TAMRA)-3'. A 73-bp sequence of the U67 open reading frame was amplified (8). The lower limit of detection was 5 copies/reaction mixture. Control standards were known copy numbers of plasmid cloned amplicon. All samples were tested in duplicate, and the mean was used to calculate the HHV-6 DNA concentration, which was expressed as log10 copies/ml of original sample. The mean difference between replicates was 8%.

Determination of HHV-6 DNA copies/cell. Five microliters of DNA extract from whole blood, serum, or CSF was subjected to quantitative HHV-6 PCR, and the result was compared with the result of quantitative PCR for human ß-globin (25). The HHV-6 PCR (8) amplifies DNA from part of the HHV-6 U67 gene, of which there is only one copy per virus genome (16). Since there are 2 copies of ß-globin/cell, the number of viral DNA copies/cell is 2 x HHV-6 DNA copies/ß-globin DNA copies (46).

Variant typing of HHV-6. Restriction enzyme analysis of PCR products was used to distinguish HHV-6A from HHV-6B, as previously described (22).

Definitions. (i) Primary HHV-6 infection. Validated tests for HHV-6 antibody avidity (42, 45, 48) and DNA (47) were used. As described elsewhere (41, 47), the diagnosis of primary HHV-6 infection was based on seroconversion to HHV-6 immunoglobulin G between acute- and convalescent-phase sera and/or PCR to detect low level HHV-6 DNA, i.e., concentration of <3.0 log10 copies/ml in an acute seronegative serum.

(ii) High-level serum HHV-6 DNA. A serum HHV-6 DNA concentration of >3.5 log10 copies/ml was defined as high based on the 95% confidence limits for the mean level found in individuals with persistent high levels of HHV-6 DNA (24, 46, 47).

(iii) High-level whole-blood HHV-6 DNA. An HHV-6 DNA concentration of >6.0 log10 copies/ml in whole blood was defined as high (8, 46).

(iv) HHV-6 chromosomal integration. In HHV-6 chromosomal integration, there is ≥1 copy of HHV-6 DNA/leukocyte and, consequently, a high viral DNA concentration in whole blood. Similarly, in serum there is ≥1 copy of HHV-6 DNA/lysed leukocyte, and the level of HHV-6 DNA is high, although about 50-fold lower than that of whole blood. These high levels define viral chromosomal integration and are not seen in other circumstances (46).

Statistics. The exact confidence limits for proportions were calculated by using the method of Armitage and Berry (3). The t distribution was used to calculate the 95% confidence limits for a sample mean. The significance of the difference between two sample means was estimated using the paired t test and the Mann Whitney two-sample rank sum test.


arrow
RESULTS
 
HHV-6 DNA in the CSF and serum of immunocompetent children with primary infection. Table 1 shows the results of testing CSF and acute-phase serum from 9 patients in group 1 (routine diagnosis patients P1 to P9) with primary infection (see "Definitions" in Materials and Methods). All were young children, <2 years old, and all presentations were similar, involving fever and convulsions sometimes accompanied by rash.


View this table:
[in this window]
[in a new window]

  		TABLE 1. Frequency of HHV-6 DNA in the CSF of immunocompetent children with primary infection

HHV-6 DNA in CSF. Five of the 9 children (56%) had HHV-6 DNA detected in the CSF. In the 4 cases where there was sufficient CSF for further tests, the mean concentration was 2.4 log10 copies/ml (95% confidence limits, 1.0 to 3.7) and the variant was B. The cell count was known for all but one of the CSF samples tested (median, <1 x 103 leukocytes/ml; range, <1 to 2).

HHV-6 DNA in serum. Seven of the 9 children had low-level HHV-6 DNA, i.e., <3.0 log10 copies/ml, detected in the acute-phase serum; in each case, this was variant B. Viral DNA was not detected in any convalescent-phase serum.

HHV-6 DNA in the CSF, serum, and whole blood of immunocompetent children and adults with viral chromosomal integration. Table 2 shows the results of testing for viral DNA in CSF, whole blood, and serum from 21 children and adults with high level HHV-6 DNA in serum and/or whole blood, i.e., viral chromosomal integration (see "Definitions" in Materials and Methods); these comprised 9 patients found to have such high-level viral DNA in group 1 (routine diagnosis patients HL8 to HL11, HL14, HL16 to HL18, and HL 20) and all of the 12 referred HHV-6 patients in group 2 (HL1 to HL7, HL12, HL13, HL15, HL19, and HL21). In all, 4 of these 21 patients had HHV-6A and 17 had HHV-6B. The patients' neurological illnesses were diverse, ranging from fever and convulsions to suspected encephalitis (confirmed in 2 patients as herpes simplex encephalitis).


View this table:
[in this window]
[in a new window]

  		TABLE 2. Frequency of HHV-6 DNA in the CSF of immunocompetent patients with high-level viral DNA in serum and/or whole blooda

HHV-6 DNA in CSF. HHV-6 DNA was detected in 20 of the 21 patients' CSF (24/26 CSF samples) (Table 2). Of the 26 CSF samples tested, the leukocyte count was known for 17 (median, 5 x 103 leukocytes/ml; range, <1 to 65). There were four samples with a cell count of <1 x 103/ml, and these included the 2 samples in which HHV-6 DNA was not found. In patient HL20, who had herpes simplex encephalitis, HHV-6 DNA was not detected in the first CSF sample, which contained <1 x 103 leukocytes/ml but was found in the later CSF sample with many more leukocytes, namely, 50 x 103 leukocytes/ml. In patients HL6, HL9, and HL15, samples had been taken long after the onset of illness, i.e., between 107 and 371 days later, yet all contained HHV-6 DNA.

In 16 samples, there was sufficient CSF to quantify the HHV-6 DNA, and the mean concentration was 4.0 log10 copies/ml (95% confidence limits, 3.5 to 4.5); this is the equivalent of an average of at least one copy/CSF leukocyte and at least a log higher than the mean HHV-6 DNA CSF concentration in primary infection (P = 0.008, paired t test; P = 0.02, Mann-Whitney two-sample rank sum test). In 2 cases, there was sufficient material to carry out a ß-globin PCR and, hence, estimate the HHV-6 DNA copies/CSF leukocyte for each individual sample; in both cases, this was ≥1.

HHV-6 DNA in serum and/or whole blood. All 21 patients had high-level HHV-6 DNA in every sample tested. For 12 of these, persistent high-level HHV-6 DNA was demonstrated, since more than one sample was available (Table 2); in the case of HL19, high-level persistence was documented in serum for over 4 years.

Prevalence of HHV-6 DNA in the CSF of immunocompetent patients with neurological illness. Table 3 shows the results for the 510 patients in group 1 (routine diagnosis patients); these comprised 200 children <2 years old and 310 older children and/or adults. Of the young children whose CSF contained HHV-6 DNA, 5 (P3, P5, P6, P8, and P9) (Table 1) had primary HHV-6 infection, and 4 (HL8 to HL10 and HL14) (Table 2) had high-level serum HHV-6 DNA and thus viral chromosomal integration (see "Definitions" in Materials and Methods). Of the older children and/or adults whose CSF contained HHV-6 DNA, there were no cases of primary infection, but 4 patients (HL16 to HL18 and HL20) (Table 2) had high-level serum HHV-6 DNA, i.e., viral chromosomal integration. The prevalence of HHV-6 DNA in CSF associated with HHV-6 chromosomal integration was 2.0% (95% confidence limits, 0.6 to 5.0) in the young children and 1.3% (95% confidence limits, 0.4 to 3.3) in the older children and/or adults; the overall prevalence for all ages was 1.6% (95% confidence limits, 0.7 to 3.1).


View this table:
[in this window]
[in a new window]

  		TABLE 3. Prevalence of HHV-6 DNA in CSF of immunocompetent patients


arrow
DISCUSSION
 
In this study of HHV-6 DNA in CSF, we compare the results for primary infection with those for viral chromosomal integration. Primary infection, always with HHV-6B, occurs early in life in almost all persons and may sometimes be accompanied by symptoms, i.e., fever and convulsions with or without a rash. In contrast, no disease has yet been causally linked to HHV-6A, nor has the time of first infection with this variant ever been identified. In primary infection with variant B, viral DNA appears transiently in serum at a low level, followed by antibody seroconversion (41, 47). Thereafter, HHV-6 becomes latent, virus is not detected in serum, and viral DNA is present at the low level of around 1 copy per 104 to 105 leukocytes (7) but not in other cell types, such as hair follicles (46).

On the other hand, in HHV-6 chromosomal integration, both peripheral blood leukocytes and hair follicle cells have a high viral load (37), and as we have recently shown, this results from ≥1 copy of HHV-6 DNA in each of these cell types (46), suggesting that every cell in the body contains virus. In fact, it seems that cases of chromosomal HHV-6 integration are usually inherited in the germ line and passed from parent to child (10, 37). Other notable features of viral chromosomal integration are the presence not only of variant B but sometimes variant A instead (8, 11, 37, 46) and persistent high-level HHV-6 DNA in whole blood and serum (46), which in the latter case, is at least 100-fold higher than that observed briefly in primary infection (47).

Thus, 21 subjects with HHV-6 chromosomal integration were identified in this study because of high viral DNA load in whole blood and/or serum (Table 2). Indeed, for 12 of the patients, persistence of this high-level HHV-6 DNA was also documented. In 4 patients, chromosomal integration was confirmed by fluorescent in situ hybridization on chromosome preparations and ≥1 copy of HHV-6 DNA/cell or lysed cell in hair follicles and whole blood/serum, respectively (8). A fifth patient had ≥1 copy of viral DNA/cell or lysed cell in whole blood and serum, but hair follicles and chromosome preparations were not tested. Moreover, another 2 patients must have inherited viral integration from their mothers, since they also had high-level serum HHV-6 DNA.

Turning now to our findings on CSF in primary infection, HHV-6 DNA was only detected in about half (56%) of CSF samples and at a low mean concentration of 2.4 log10 copies/ml. This presumably reflects the concurrent and similarly brief low-level HHV-6 DNA in serum or plasma seen in the first few days of primary infection (6, 36, 47). Indeed, it has been previously reported that HHV-6 DNA appears transiently in CSF at this time (35).

Notably, almost all of the CSF samples (92%) from the 21 patients with viral chromosomal integration contained HHV-6 DNA, and unlike primary infection, where more than one CSF was available for testing, HHV-6 DNA was shown to persist in every case, even up to a year after the original onset of illness. The mean CSF viral DNA concentration for all samples was 4.0 log10 copies/ml and more than 10-fold higher than that in primary infection. On the basis of the median CSF cell count, it could be calculated that, as expected for viral integration, there was, on average, at least one HHV-6 copy/CSF leukocyte, and this was also confirmed for two individual samples by comparing HHV-6 and human ß-globin concentrations. HHV-6 DNA could even be detected in normal CSF with no evidence of inflammation, i.e., the CSF cell count was ≤5 x 103/ml. However, when the cell count was at its lowest, i.e., <1 x 103 cells/ml, only half of the samples tested contained detectable HHV-6 DNA, presumably because our test was at the limit of sensitivity.

HHV-6 DNA in CSF is usually taken to indicate active infection, but in chromosomal viral integration, there is no evidence to date of virus replication (27, 38). Thus, many of our patients with integrated virus were initially given a misdiagnosis of HHV-6 encephalitis because of viral DNA in CSF, although they had disparate symptoms, final diagnoses, and outcomes, including 2 patients with confirmed cases of herpes simplex encephalitis, one of whom died (Table 2). It is also worth noting that ganciclovir therapy with its frequent adverse effects was initiated unnecessarily in one case because of such a misdiagnosis (submitted for publication).

Similar confusion has probably arisen in the literature. Several cases from a large study of patients of all ages with focal encephalitis were attributed to HHV-6 because viral DNA was detected in CSF (28), but in the absence of quantitative measurement of HHV-6 DNA, it is difficult to differentiate primary infection from viral integration and the role of the virus is unclear. Turning to older individuals in whom primary infection is extremely unlikely, there are a few case reports describing, in all, 11 immunocompetent adults and 1 teenager. All had clinically defined encephalitis and HHV-6 DNA in their CSF (4, 5, 13, 21, 26, 29, 30, 33, 39), and in each case, the diagnosis was given as HHV-6 encephalitis but viral integration had not been considered. Viral DNA load in CSF was measured in 7 patients; low level HHV-6 DNA was found in 2 of these but in both primary infection was excluded (29, 30) suggesting viral reactivation. The remaining 5 had high viral DNA levels (≥4.0 log10 copies/ml) (5, 21), which although not noted in the reports, is equivalent to at least 1 viral copy/CSF leukocyte, strongly suggesting chromosomal HHV-6 integration. Moreover, in 1 of these 5 patients HHV-6 DNA persisted in CSF for at least 55 days despite therapy with ganciclovir and was also in serum at a high level, in this case ≥5.0 log10 copies/ml (5). Thus, unrecognized chromosomal viral integration may often account for HHV-6 DNA in CSF.

Additional support for the idea that chromosomal HHV-6 integration commonly results in viral DNA in CSF in immunocompetent individuals comes from instances in which the HHV-6 variant was typed. There are a remarkable number of cases of encephalitis in immunocompetent adults attributed to variant A, 6 in all (4, 13, 26, 29, 30, 39), as opposed to one attributed to variant B (5, 28). As previously discussed, HHV-6B, not HHV-6A, is responsible for primary infection in childhood, whereas either variant A or B can be integrated into human chromosomes. These findings are once again confirmed in the present paper, where only HHV-6B was detected in the CSF in primary infection and variant A was found in the CSF of some of our patients with evidence of integrated virus and variant B in others. It may therefore be concluded that, when HHV-6A rather than B DNA is detected in CSF, this most likely indicates viral integration. Such integration may well account for the mistaken idea (18) that, since HHV-6A tends to persist in CSF, it is more neurotropic than variant B.

Regarding the 1.6% prevalence of HHV-6 DNA in the CSF due to chromosomal integration in our immunocompetent patients, there was no appreciable difference between young children <2 years old and older children and/or adults, i.e., 2.0 and 1.3%, respectively, findings suggesting that viral integration is always acquired very early in life and consistent with vertical transmission, i.e., inheritance. As expected for a common cause of neurological disease in young children (41), primary infection was also responsible for viral DNA in the CSF of this age group. In contrast, viral chromosomal integration was the main cause of HHV-6 DNA in the CSF of older children and adults who were past the age for primary infection.

Of the prior surveys of the prevalence of HHV-6 DNA in the CSF of predominantly immunocompetent populations, all, as in our case, were based on samples referred for diagnosis of suspected viral CNS infection. The results were 0.05% (1/2,161) (31), 0.3% (1/320) (15), 1.2% (9/753) (12), 1.5% (6/407) (34), and 2.8% (3/106) (20). All but one of these surveys included at least some young children but without analysis for differences due to age. However, two further studies did analyze their results in this way. In one case (2), a prevalence of 2.0% (3/148) was found in children <2 years, but all 3 subjects were less than 2 months old, suggesting acquisition at birth, i.e., chromosomally inherited HHV-6. Isaacson et al. (21), divided their results into those for young children, ≤3 years old (0%, 0/98), and older children and adults (0.4%, 4/902), thus excluding HHV-6 DNA in CSF due to primary infection in the latter group. In summary, although not considered a possibility by the authors, the prevalences in all the above studies are of the same order as that attributed by us to HHV-6 chromosomal integration, suggesting that, in most of these instances, HHV-6 DNA in CSF resulted from this phenomenon.

Although neither our survey of HHV-6 DNA in CSF nor those discussed above included normal controls, the prevalence in such controls due to viral integration should be between 0.7% (95% confidence limits, 0.2 to 2.1) and 1.5% (95% confidence limits, 0.7 to 2.8) as judged by our two separate reports of high level serum or plasma HHV-6 DNA, i.e., presumed chromosomal integration, in control populations (24, 47). Further support for these estimates comes from the reported prevalences of between 0.9 to 1.6% for congenital HHV-6 infection (1, 9, 17), i.e., presumed chromosomal integration. All of these frequencies are remarkably similar to the prevalence of 1.6% (95% confidence limits, 0.7 to 3.1) HHV-6 DNA in our CSF samples from immunocompetent patients of all ages with various neurological symptoms. Davies et al. (12) attempted to solve the problem of controls in their study of suspected CNS infections by using clinical and laboratory criteria to define a group of patients unlikely to have CNS viral infection and found a prevalence of 0.3% (95% confidence limits, 0.01 to 2.8) for HHV-6 DNA in CSF, a finding no different from ours. The only other information comes from controls without CNS disease (40) in whom 1 individual of 107 (95% confidence limits, 0.02 to 5.1) had HHV-6 DNA persisting in two CSF samples collected 4 months apart, presumably because of viral chromosomal integration. From the limited evidence available, the prevalence of HHV-6 DNA in the CSF due to viral chromosomal integration in those with suspected viral CNS infection is the same as that in controls, suggesting that such integration does not predispose to neurological disease.

It may be concluded, therefore, that where HHV-6 DNA is detected in the CSF of immunocompetent patients, it is commonly due to chromosomal viral integration resulting in a mistaken association with encephalitis. This is especially so for older children and adults in whom primary infection, the other common cause of HHV-6 DNA in CSF, is exceptionally rare. A recent editorial commentary (49) asked "Human herpesvirus 6 infection of the central nervous system: is it just a case of mistaken association?" The present findings go a long way toward answering this question; our results show that any diagnosis of HHV-6 encephalitis should not be made without first excluding chromosomal HHV-6 integration by measuring the DNA load in CSF, serum, and/or whole blood. Further support for such integration would be provided by the detection of HHV-6 DNA in hair follicle cells.


arrow
ACKNOWLEDGMENTS
 
We thank the British Pediatric Surveillance Unit for invaluable access to its network in Great Britain and the Republic of Ireland and are most grateful to N. J. Andrews for statistical advice. We also much appreciate the vital contribution of the many pediatricians, microbiologists. and virologists who took time and trouble to refer cases to us with samples for diagnosis.

This work was supported by the Wellcome Trust (project grant 051350/Z to K. N. Ward) and the National Medical Council of Singapore (fellowship for H. N. Leong).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Centre for Virology, Division of Infection and Immunity, Royal Free and University College Medical School (UCL campus), Windeyer Institute of Medical Sciences, 46 Cleveland Street, London W1T 4JF, United Kingdom. Phone: 44 20 7679 9490. Fax: 44 20 7580 5896. E-mail: k.n.ward{at}ucl.ac.uk Back

{triangledown} Published ahead of print on 17 January 2007. Back

{dagger} Present address: Virology, Barts and the London NHS Trust, 80 Newark Street, London E1 2ES, United Kingdom. Back


arrow
REFERENCES
 
    1
  1. Adams, O., C. Krempe, G. Kogler, P. Wernet, and A. Scheid. 1998. Congenital infections with human herpesvirus 6. J. Infect. Dis. 178:544-546.[Medline]
    2. 2
  2. Ansari, A., S. Li, M. J. Abzug, and A. Weinberg. 2004. Human herpesviruses 6 and 7 and central nervous system infection in children. Emerg. Infect. Dis. 10:1450-1454.[Medline]
    3. 3
  3. Armitage, P., and G. Berry. 1987. Statistical methods in medical research, p. 117-120. Blackwell, Oxford, United Kingdom.
    4. 4
  4. Beovic, B., N. Pecaric-Meglic, J. Marin, J. Bedernjak, I. Muzlovic, and M. Cizman. 2001. Fatal human herpesvirus 6-associated multifocal meningoencephalitis in an adult female patient. Scand. J. Infect. Dis. 33:942-944.[CrossRef][Medline]
    5. 5
  5. Birnbaum, T., C. S. Padovan, B. Sporer, T. A. Rupprecht, H. Ausserer, G. Jaeger, and H. W. Pfister. 2005. Severe meningoencephalitis caused by human herpesvirus 6 type B in an immunocompetent woman treated with ganciclovir. Clin. Infect. Dis. 40:887-889.[CrossRef][Medline]
    6. 6
  6. Chiu, S. S., C. Y. Cheung, C. Y. Tse, and M. Peiris. 1998. Early diagnosis of primary human herpesvirus 6 infection in childhood: serology, polymerase chain reaction, and virus load. J. Infect. Dis. 178:1250-1256.[CrossRef][Medline]
    7. 7
  7. Clark, D. A., M. Ait-Khaled, A. C. Wheeler, I. M. Kidd, J. E. McLaughlin, M. A. Johnson, P. D. Griffiths, and V. C. Emery. 1996. Quantification of human herpesvirus 6 in immunocompetent persons and post-mortem tissues from AIDS patients by PCR. J. Gen. Virol. 77(Pt 9):2271-2275.[Abstract/Free Full Text]
    8. 8
  8. Clark, D. A., E. P. Nacheva, H. N. Leong, D. Brazma, Y. T. Li, E. H. Tsao, H. C. Buyck, C. E. Atkinson, H. M. Lawson, M. N. Potter, and P. D. Griffiths. 2006. Transmission of integrated human herpesvirus 6 through stem cell transplantation: implications for laboratory diagnosis. J. Infect. Dis. 193:912-916.[CrossRef][Medline]
    9. 9
  9. Dahl, H., G. Fjaertoft, T. Norsted, F. Z. Wang, M. Mousavi-Jazi, and A. Linde. 1999. Reactivation of human herpesvirus 6 during pregnancy. J. Infect. Dis. 180:2035-2038.[CrossRef][Medline]
    10. 10
  10. Daibata, M., T. Taguchi, Y. Nemoto, H. Taguchi, and I. Miyoshi. 1999. Inheritance of chromosomally integrated human herpesvirus 6 DNA. Blood 94:1545-1549.[Abstract/Free Full Text]
    11. 11
  11. Daibata, M., T. Taguchi, T. Sawada, H. Taguchi, and I. Miyoshi. 1998. Chromosomal transmission of human herpesvirus 6 DNA in acute lymphoblastic leukaemia. Lancet 352:543-544.[CrossRef][Medline]
    12. 12
  12. Davies, N. W., L. J. Brown, J. Gonde, D. Irish, R. O. Robinson, A. V. Swan, J. Banatvala, R. S. Howard, M. K. Sharief, and P. Muir. 2005. Factors influencing PCR detection of viruses in cerebrospinal fluid of patients with suspected CNS infections. J. Neurol. Neurosurg. Psychiatr. 76:82-87.[Abstract/Free Full Text]
    13. 13
  13. Denes, E., L. Magy, K. Pradeau, S. Alain, P. Weinbreck, and S. Ranger-Rogez. 2004. Successful treatment of human herpesvirus 6 encephalomyelitis in immunocompetent patient. Emerg. Infect. Dis. 10:729-731.[Medline]
    14. 14
  14. Dewhurst, S., K. McIntyre, K. Schnabel, and C. B. Hall. 1993. Human herpesvirus 6 (HHV-6) variant B accounts for the majority of symptomatic primary HHV-6 infections in a population of U.S. infants. J. Clin. Microbiol. 31:416-418.[Abstract/Free Full Text]
    15. 15
  15. Glaser, C. A., S. Gilliam, D. Schnurr, B. Forghani, S. Honarmand, N. Khetsuriani, M. Fischer, C. K. Cossen, and L. J. Anderson. 2003. In search of encephalitis etiologies: diagnostic challenges in the California Encephalitis Project, 1998-2000. Clin. Infect. Dis. 36:731-742.[CrossRef][Medline]
    16. 16
  16. Gompels, U. A., J. Nicholas, G. Lawrence, M. Jones, B. J. Thomson, M. E. Martin, S. Efstathiou, M. Craxton, and H. A. Macaulay. 1995. The DNA sequence of human herpesvirus-6: structure, coding content, and genome evolution. Virology 209:29-51.[CrossRef][Medline]
    17. 17
  17. Hall, C. B., M. T. Caserta, K. C. Schnabel, C. Boettrich, M. P. McDermott, G. K. Lofthus, J. A. Carnahan, and S. Dewhurst. 2004. Congenital infections with human herpesvirus 6 (HHV6) and human herpesvirus 7 (HHV7). J. Pediatr. 145:472-477.[CrossRef][Medline]
    18. 18
  18. Hall, C. B., M. T. Caserta, K. C. Schnabel, C. Long, L. G. Epstein, R. A. Insel, and S. Dewhurst. 1998. Persistence of human herpesvirus 6 according to site and variant: possible greater neurotropism of variant A. Clin. Infect. Dis. 26:132-137.[Medline]
    19. 19
  19. Hall, C. B., C. E. Long, K. C. Schnabel, M. T. Caserta, K. M. McIntyre, M. A. Costanzo, A. Knott, S. Dewhurst, R. A. Insel, and L. G. Epstein. 1994. Human herpesvirus-6 infection in children. A prospective study of complications and reactivation. N. Engl. J. Med. 331:432-438.[Abstract/Free Full Text]
    20. 20
  20. Ibrahim, A. I., M. T. Obeid, M. J. Jouma, K. Roemer, N. Mueller-Lantzsch, and B. C. Gartner. 2005. Prevalence of herpes simplex virus (types 1 and 2), varicella-zoster virus, cytomegalovirus, and human herpesvirus 6 and 7 DNA in cerebrospinal fluid of Middle Eastern patients with encephalitis. J. Clin. Microbiol. 43:4172-4174.[Abstract/Free Full Text]
    21. 21
  21. Isaacson, E., C. A. Glaser, B. Forghani, Z. Amad, M. Wallace, R. W. Armstrong, M. M. Exner, and S. Schmid. 2005. Evidence of human herpesvirus 6 infection in 4 immunocompetent patients with encephalitis. Clin. Infect. Dis. 40:890-893.[CrossRef][Medline]
    22. 22
  22. Kidd, I. M., D. A. Clark, J. A. Bremner, D. Pillay, P. D. Griffiths, and V. C. Emery. 1998. A multiplex PCR assay for the simultaneous detection of human herpesvirus 6 and human herpesvirus 7, with typing of HHV-6 by enzyme cleavage of PCR products. J. Virol. Methods. 70:29-36.[CrossRef][Medline]
    23. 23
  23. Kondo, K., H. Nagafuji, A. Hata, C. Tomomori, and K. Yamanishi. 1993. Association of human herpesvirus 6 infection of the central nervous system with recurrence of febrile convulsions. J. Infect. Dis. 167:1197-1200.[Medline]
    24. 24
  24. Leong, H. N., P. W. Tuke, R. S. Tedder, A. B. Khalom, R. Eglin, C. E. Atkinson, K. N. Ward, P. D. Griffiths, and D. A. Clark. 2007. The prevalence of chromosomally integrated human herpesvirus 6 genomes in the blood of UK blood donors. J. Med. Virol. 79:45-51.[CrossRef][Medline]
    25. 25
  25. Lo, Y. M., M. S. Tein, T. K. Lau, C. J. Haines, T. N. Leung, P. M. Poon, J. S. Wainscoat, P. J. Johnson, A. M. Chang, and N. M. Hjelm. 1998. Quantitative analysis of fetal DNA in maternal plasma and serum: implications for noninvasive prenatal diagnosis. Am. J. Hum. Genet. 62:768-775.[CrossRef][Medline]
    26. 26
  26. Losada, I., F. Pozo, A. Tenorio, and D. Damaso. 2003. Meningoencephalitis caused by HHV-6A in a previously healthy immunocompetent adult. Med. Clin. (Barcelona) 120:357.[CrossRef][Medline]
    27. 27
  27. Luppi, M., R. Marasca, P. Barozzi, S. Ferrari, L. Ceccherini-Nelli, G. Batoni, E. Merelli, and G. Torelli. 1993. Three cases of human herpesvirus-6 latent infection: integration of viral genome in peripheral blood mononuclear cell DNA. J. Med. Virol. 40:44-52.[Medline]
    28. 28
  28. McCullers, J. A., F. D. Lakeman, and R. J. Whitley. 1995. Human herpesvirus 6 is associated with focal encephalitis. Clin. Infect. Dis. 21:571-576.[Medline]
    29. 29
  29. Portolani, M., M. Pecorari, M. G. Tamassia, W. Gennari, F. Beretti, and G. Guaraldi. 2001. Case of fatal encephalitis by HHV-6 variant A. J. Med. Virol. 65:133-137.[CrossRef][Medline]
    30. 30
  30. Portolani, M., M. G. Tamassia, W. Gennari, M. Pecorari, F. Beretti, M. Alu, A. Maiorana, and M. Migaldi. 2005. Post-mortem diagnosis of encephalitis in a 75-year-old man associated with human herpesvirus-6 variant A. J. Med. Virol. 77:244-248.[CrossRef][Medline]
    31. 31
  31. Read, S. J., K. J. Jeffery, and C. R. Bangham. 1997. Aseptic meningitis and encephalitis: the role of PCR in the diagnostic laboratory. J. Clin. Microbiol. 35:691-696.[Abstract]
    32. 32
  32. Salahuddin, S. Z., D. V. Ablashi, P. D. Markham, S. F. Josephs, S. Sturzenegger, M. Kaplan, G. Halligan, P. Biberfeld, F. Wong-Staal, B. Kramarsky, and R. C. Gallo. 1986. Isolation of a new virus, HBLV, in patients with lymphoproliferative disorders. Science 234:596-601.[Abstract/Free Full Text]
    33. 33
  33. Sloots, T. P., I. M. Mackay, and P. Carroll. 1993. Meningoencephalitis in an adult with human herpesvirus-6 infection. Med. J. Aust. 159:838.[Medline]
    34. 34
  34. Studahl, M., L. Hagberg, E. Rekabdar, and T. Bergstrom. 1999. Hematogenously spread herpesviruses are detected as frequently as neuronally spread herpesviruses in cerebrospinal fluid by polymerase chain reaction assay. Clin. Infect. Dis. 29:216-218.[Medline]
    35. 35
  35. Suga, S., T. Yoshikawa, Y. Asano, T. Kozawa, T. Nakashima, I. Kobayashi, T. Yazaki, H. Yamamoto, Y. Kajita, T. Ozaki, Y. Nishimura, T. Yamanaka, A. Yamada, and J. Imanishi. 1993. Clinical and virological analyses of 21 infants with exanthem subitum (roseola infantum) and central nervous system complications. Ann. Neurol. 33:597-603.[CrossRef][Medline]
    36. 36
  36. Suga, S., T. Yoshikawa, Y. Kajita, T. Ozaki, and Y. Asano. 1998. Prospective study of persistence and excretion of human herpesvirus-6 in patients with exanthem subitum and their parents. Pediatrics 102:900-904.[Abstract/Free Full Text]
    37. 37
  37. Tanaka-Taya, K., J. Sashihara, H. Kurahashi, K. Amo, H. Miyagawa, K. Kondo, S. Okada, and K. Yamanishi. 2004. Human herpesvirus 6 (HHV-6) is transmitted from parent to child in an integrated form and characterization of cases with chromosomally integrated HHV-6 DNA. J. Med. Virol. 73:465-473.[CrossRef][Medline]
    38. 38
  38. Torelli, G., P. Barozzi, R. Marasca, P. Cocconcelli, E. Merelli, L. Ceccherini-Nelli, S. Ferrari, and M. Luppi. 1995. Targeted integration of human herpesvirus 6 in the p arm of chromosome 17 of human peripheral blood mononuclear cells in vivo. J. Med. Virol. 46:178-188.[Medline]
    39. 39
  39. Torre, D., F. Speranza, R. Martegani, P. Ferrante, E. Omodeo-Zorini, R. Mancuso, and G. P. Fiori. 1998. Meningoencephalitis caused by human herpesvirus-6 in an immunocompetent adult patient: case report and review of the literature. Infection 26:402-404.[Medline]
    40. 40
  40. Wang, F. Z., A. Linde, H. Hagglund, M. Testa, A. Locasciulli, and P. Ljungman. 1999. Human herpesvirus 6 DNA in cerebrospinal fluid specimens from allogeneic bone marrow transplant patients: does it have clinical significance? Clin. Infect. Dis. 28:562-568.[Medline]
    41. 41
  41. Ward, K. N., N. J. Andrews, C. M. Verity, E. Miller, and E. M. Ross. 2005. Human herpesviruses-6 and -7 each cause significant neurological morbidity in Britain and Ireland. Arch. Dis. Child. 90:619-623.[Abstract/Free Full Text]
    42. 42
  42. Ward, K. N., X. Couto Parada, J. Passas, and A. D. Thiruchelvam. 2002. Evaluation of specificity and sensitivity of indirect immunofluorescence tests for IgG to human herpesviruses-6 and -7. J. Virol. Methods 106:107-113.[CrossRef][Medline]
    43. 43
  43. Ward, K. N., and J. J. Gray. 1994. Primary human herpesvirus-6 infection is frequently overlooked as a cause of febrile fits in young children. J. Med. Virol. 42:119-123.[Medline]
    44. 44
  44. Ward, K. N., J. J. Gray, and S. Efstathiou. 1989. Brief report: primary human herpesvirus 6 infection in a patient following liver transplantation from a seropositive donor. J. Med. Virol. 28:69-72.[Medline]
    45. 45
  45. Ward, K. N., J. J. Gray, M. W. Fotheringham, and M. J. Sheldon. 1993. IgG antibodies to human herpesvirus-6 in young children: changes in avidity of antibody correlate with time after infection. J. Med. Virol. 39:131-138.[Medline]
    46. 46
  46. Ward, K. N., H. N. Leong, E. P. Nacheva, J. Howard, C. E. Atkinson, N. W. Davies, P. D. Griffiths, and D. A. Clark. 2006. Human herpesvirus 6 chromosomal integration in immunocompetent patients results in high levels of viral DNA in blood, sera, and hair follicles. J. Clin. Microbiol. 44:1571-1574.[Abstract/Free Full Text]
    47. 47
  47. Ward, K. N., A. D. Thiruchelvam, and X. Couto-Parada. 2005. Unexpected occasional persistence of high levels of HHV-6 DNA in sera; detection of variants A and B. J. Med. Virol. 76:563-570.[CrossRef][Medline]
    48. 48
  48. Ward, K. N., D. J. Turner, X. Couto Parada, and A. D. Thiruchelvam. 2001. Use of immunoglobulin G antibody avidity for differentiation of primary human herpesvirus 6 and 7 infections. J. Clin. Microbiol. 39:959-963.[Abstract/Free Full Text]
    49. 49
  49. Whitley, R. J., and F. D. Lakeman. 2005. Human herpesvirus 6 infection of the central nervous system: is it just a case of mistaken association? Clin. Infect. Dis. 40:894-895.[CrossRef][Medline]
    50. 50
  50. Yamanishi, K., T. Okuno, K. Shiraki, M. Takahashi, T. Kondo, Y. Asano, and T. Kurata. 1988. Identification of human herpesvirus-6 as a causal agent for exanthem subitum. Lancet i:1065-1067.
    51. 51
  51. Yoshikawa, T., and Y. Asano. 2000. Central nervous system complications in human herpesvirus-6 infection. Brain Dev. 22:307-314.[CrossRef][Medline]
    52. 52
  52. Yoshikawa, T., S. Suga, Y. Asano, T. Yazaki, H. Kodama, and T. Ozaki. 1989. Distribution of antibodies to a causative agent of exanthem subitum (human herpesvirus-6) in healthy individuals. Pediatrics 84:675-677.[Abstract/Free Full Text]

Journal of Clinical Microbiology, April 2007, p. 1298-1304, Vol. 45, No. 4
0095-1137/07/$08.00+0     doi:10.1128/JCM.02115-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Del Borgo, C., Zaniratti, S., Minosse, C., Vetica, A., Bellini, A., Soscia, F., Missori, P., Pierelli, F., Curra, A. (2009). A CASE OF ACUTE POLYRADICULONEUROPATHY, DRUG-INDUCED HYPERSENSITIVITY, AND HHV-6 INFECTION. Neurology 72: 935-936 [Full Text]  
  • Provenzale, J. M., vanLandingham, K. E., Lewis, D. V., Mukundan, S. Jr, White, L. E. (2008). Extrahippocampal Involvement in Human Herpesvirus 6 Encephalitis Depicted at MR Imaging. Radiology 249: 955-963 [Abstract] [Full Text]  
  • Potenza, L., Luppi, M., Barozzi, P., Rossi, G., Cocchi, S., Codeluppi, M., Pecorari, M., Masetti, M., Di Benedetto, F., Gennari, W., Portolani, M., Gerunda, G. E., Lazzarotto, T., Landini, M. P., Schulz, T. F., Torelli, G., Guaraldi, G. (2008). HHV-6A in Syncytial Giant-Cell Hepatitis. NEJM 359: 593-602 [Abstract] [Full Text]  
  • Flamand, L., Gravel, A., Boutolleau, D., Alvarez-Lafuente, R., Jacobson, S., Malnati, M. S., Kohn, D., Tang, Y.-W., Yoshikawa, T., Ablashi, D. (2008). Multicenter Comparison of PCR Assays for Detection of Human Herpesvirus 6 DNA in Serum. J. Clin. Microbiol. 46: 2700-2706 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ward, K. N.
Right arrow Articles by Clark, D. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ward, K. N.
Right arrow Articles by Clark, D. A.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»