Previous Article | Next Article ![]()
Journal of Clinical Microbiology, May 2007, p. 1535-1543, Vol. 45, No. 5
0095-1137/07/$08.00+0 doi:10.1128/JCM.02007-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Centre for Infections, Health Protection Agency, 61 Colindale Avenue, Colindale, London NW9 5HT, United Kingdom
Received 28 September 2006/ Returned for modification 26 November 2006/ Accepted 6 March 2007
|
|
|---|
|
|
|---|
|
|
|---|
|
View this table: [in a new window] |
TABLE 1. Viruses analyzed in this study
|
Specificity panel preparation. Specificity panels were prepared to determine the cross-reactivity of the H5 RT-PCR assay with other influenza A viruses (Table 1). Specificity panel A contained cultured avian and human influenza A H5N1 viruses diluted in viral transport medium (VTM). Specificity panel B contained egg-grown influenza A viruses of different subtypes (H1 to H15) diluted in VTM. Specificity panel C was prepared by spiking pooled respiratory clinical samples (combined nose and throat [N/T] swabs) that had previously tested negative for influenza A viruses H1 and H3, influenza B viruses, and respiratory syncytial virus A (RSVA) and RSVB by RT-PCR (28) with human influenza B and C viruses and other respiratory viruses listed in Table 1. For panel D, 300 combined N/T swab samples from patients presenting with influenza and influenza-like illness were analyzed. The samples were collected by a subset of the practitioners in the Birmingham Unit of the Royal College of General Practitioners Network during the influenza seasons of 2000 through 2006 (12).
Determination of sensitivity of H5 RT-PCR assays. (i) Titration of virus infectivity. Infectivity assays were performed as previously described by using Madin-Darby canine kidney cells (11). Tenfold dilutions (101 to 1012) of influenza A viruses representative of H5 HA clades (clade 1, NIBRG14 [A/Vietnam/1194/2004]; clade 2, NIBRG23 [A/Turkey/Turkey/1/2005]; and clade 3, A/Duck/Singapore-Q/F119-3/1997) were prepared in VTM. Aliquots of each virus dilution (100 µl) were analyzed by the infectivity assay.
(ii) RT-PCR. Freshly prepared aliquots of each virus dilution were subjected to nucleic acid extraction, and RT-PCR was performed with the H5 TaqMan real-time assay to determine the sensitivity of the assay and the amplification efficiency of the RT-PCR.
(iii) Spiked clinical material. Tenfold dilution series (101 to 1012) of NIBRG14 and A/Duck/Singapore-Q/F119-3/1997 H5 viruses were also spiked in clinical material as previously described. Viral RNA was purified from aliquots of each dilution and amplified with the H5 real-time RT-PCR to determine the end point of detection. The NIBRG14 and A/Duck/Singapore-Q/F119-3/1997 viruses were also spiked at three different concentrations (102, 104, and 106) into N/T swab, sputum, and human serum samples that previously tested negative for influenza and RSV viruses by multiplex RT-PCR (28). Nucleic acid was extracted from these spiked samples, and the detection of H5 viral RNA was performed with the H5 TaqMan real-time RT-PCR assay.
H5 positive control material. Aliquots of 600 µl of influenza A H5N3 A/Duck/Singapore-Q/F119-3/1997 virus (2.5 x 108 PFU/ml) mixed with 200 µl guanidinium isothiocyanate lysis buffer (Severn Biotech Ltd., Worcester, United Kingdom) were prepared and stored at 80°C until use. The control material was validated with the H5 TaqMan real-time RT-PCR assay and quality assured (Conformité Européenne marked) following standard stability and stress testing (http://www.hpa.org.uk/srmd/div_esl_qcu/products.htm).
Clinical samples. Respiratory samples (N/T swabs, sputum, and nasopharyngeal aspirates) from returning travelers who were suspected to have avian H5 influenza infections according to the HPA case definition (http://www.hpa.org.uk/infections/topics_az/influenza/avian/case_definition.htm) presenting to hospitals in England with influenza-like illnesses were sent directly to HPA for primary H5 diagnostic testing. Patient samples (150 µl) were aliquoted into 840 µl guanidinium thiocyanate (GSCN) and Triton X-100 containing lysis buffer (Roche Diagnostics, Mannheim, Germany) in a CL3 laboratory prior to viral RNA extraction at CL2. Viral RNA or cDNA was analyzed in parallel, following a diagnostic algorithm for analyzing samples from patients suspected of H5 infection, by using the H5 TaqMan real-time RT-PCR assay, a multiplex RT-PCR for the detection of influenza A H1 and H3, influenza B, and RSVA and RSVB viruses (28), and a pan-influenza A RT-PCR targeting the matrix gene of all influenza A viruses (11). The H5 positive control virus was processed in the same way as the clinical specimens.
In addition, five respiratory samples (nasopharyngeal and lung) collected during an H5N1 human outbreak in Europe during 2006 were kindly provided by the WHO Collaborating Centre for Reference and Research on Influenza, Mill Hill, London, United Kingdom. Patient samples (100 µl) were aliquoted into lysis buffer, as described above, in a CL4 laboratory prior to viral RNA extraction at CL2. Viral RNA was then analyzed using the H5 TaqMan real-time RT-PCR assay.
Nucleic acid extraction and RT. The choice of extraction technique depended on the location of analysis (CL2, CL3, or CL4 laboratory), urgency of sample processing, and logistic factors, e.g., the number of samples to be analyzed.
The automated MagNAPure nucleic acid isolation system with a total nucleic acid isolation kit (Roche Diagnostics) was used to purify viral RNA from aliquots (150 µl) of samples in specificity panels B, C, and D. MagNAPure-purified nucleic acids were eluted in a final volume of 100 µl. Viral RNA was extracted from samples (150 µl) in specificity panel A and from respiratory secretions taken from suspected H5 patients by using 840 µl GSCN lysis buffer and 10 µl silica suspension (Severn Biotech Ltd.) as previously described and eluted in 30 µl nuclease-free water (4, 28).
Dilution series of A/Duck/Singapore-Q/F119-3/1997 H5 virus prepared in duplicate in N/T swab clinical material or VTM were also extracted in parallel by the GSCN-silica method (150 µl) and with a QIAGEN viral RNA extraction kit (140 µl) (QIAGEN Ltd., West Sussex, United Kingdom). Viral RNA purified with a QIAGEN kit was eluted in a final volume of 60 µl.
RT of viral RNA to cDNA for use in two-step RT-PCR assays was performed as previously described (11, 28).
H5 TaqMan real-time one-step RT-PCR assay. Conserved target regions of the HA of influenza A H5 viruses were identified following alignment of all human A H5N1 and representative avian H5 virus HA nucleotide sequences publicly available from the Los Alamos influenza sequence database (19). HA-specific influenza virus H5 primers and a minor groove binder probe were designed for the H5 TaqMan real-time assay by using Primer Express software (Applied Biosystems, Cheshire, United Kingdom). Optimal primer and probe concentration and amplification conditions were determined. Final conditions for a 50-µl reaction mixture used 25 µl 2x QuantiTect probe RT-PCR master mix containing 6-carboxy-X-rhodamine as a passive reference (QIAGEN QuantiTect probe RT-PCR kit), 900 nM each primer (H5Forward [5' GCCGAATGATGCMATMAAYT 3'] and H5Reverse [5' CGCACCCATTGGAGTTTGAC 3']), 200 nM TaqMan minor groove binder probe (H5probe [5' 6-carboxyfluorescein-CATTGCTCCAGAAWAT-MGBNFQ 3']), 0.5 µl QuantiTect RT mix (QIAGEN QuantiTect probe RT-PCR kit), and 2 µl viral RNA template. The determination of the sensitivity of the H5 real-time RT-PCR assay was performed using the above protocol and also using the following 50-µl reaction mixture: 25 µl 2x RT-PCR mix (SuperScript III Platinum one-step quantitative RT-PCR kit; Invitrogen, Paisley, Scotland), 900 nM each primer (H5Forward and H5Reverse), 200 nM TaqMan minor groove binder probe (H5probe), 8 µl SuperScript III RT/Platinum Taq mix, 1 µl 6-carboxy-X-rhodamine reference dye, and 2 µl viral RNA template. All samples and controls were tested in duplicate. The PCR thermal profile consisted of an initial RT step of 50°C for 30 min, followed by 15 min at 95°C, and 40 cycles of 15 s at 94°C and 60 s at 60°C. Amplification, detection, and data analysis were performed on an ABI Prism 7000 real-time thermal cycler, with "FAM no quencher" selected as the detector. The baseline was set to where no fluorescence emissions were detectable and five cycles before the start of amplification was detected. Since cycle threshold (CT) values greater than 38.00 were observed to approach the sensitivity limits of the real-time detection system, CT values of less than 38.00 were considered positive detections by amplification of the target template.
Confirmatory strategies. The strategies for the diagnosis and confirmation of H5 virus infection were shown in Fig. 1. Confirmatory strategies were based on nucleotide differences between H5 clade 1, 2, and 3 viruses identified following the alignment of HA sequences. The phylogenetic tree was constructed using publicly available H5 HA sequences, representing clades 1, 1', 2, and 3, with sequences (nucleotide positions 181 to 1273) aligned by ClustalW (16).
![]() View larger version (25K): [in a new window] |
FIG. 1. Diagram of H5 RT-PCR strategy and confirmatory assays for diagnosis and verification of H5N1 infection as described in this report. The lengths of the horizontal lines are proportional to the nucleotide differences (%) between sequences as indicated by the scale. The detection of H5 viral RNA by the TaqMan H5 real-time RT-PCR assay is confirmed by PCR restriction enzyme digest or direct sequencing of the real-time amplicon or by pyrosequencing RT-PCR of a 5-nucleotide discriminatory region of the H5 HA gene.
|
I. Fifteen microliters of the H5 TaqMan real-time RT-PCR mix containing the 151-bp PCR product amplified from the HA1 portion of the influenza A H5 HA was added to 0.5 µl of the restriction enzymes MseI (5 U) or Taq
I (10 U) (New England Biolabs, Beverly, MA) for a minimum of 60 min at 37°C or 60°C, respectively, in 50 mM NaCl-10 mM Tris-HCl-10 mM MgCl2-1 mM dithiothreitol-100 µg/ml bovine serum albumin [pH 7.9] for MseI digestion or 100 mM NaCl-50 mM Tris-HCl-10 mM MgCl2-1 mM dithiothreitol-100 µg/ml bovine serum albumin [pH 7.9] for Taq
I digestion. The products of enzyme digestion were visualized by ethidium bromide staining following electrophoresis on a 3% molecular screening agarose gel (Roche Diagnostics). (ii) Pyrosequencing confirmation analysis. For confirmation of the detection of WT H5 viral RNA by differentiation from H5 positive control amplicons, and analysis of H5 WT sequence, a pyrosequencing assay was performed. By using PSQ assay design software (Biotage, Uppsala, Sweden), PCR primers (H5pyroF1 [5' biotin-ACA GAG CAG GTT GAC ACA ATA AT-3'] and H5pyroR2 [5'-CGT GTT TCA CTT CTT CAT AGT C-3']) were designed to amplify a 274-bp region (113 to 386 bp) of the HA1 portion of the influenza H5 virus HA molecule and sequence a 5-bp region (232 to 236 bp) within the PCR amplicon by using the sequencing primer H5pyroS1 (5'-TCC AGC TAC ACT ACA AT-3'). RT of viral RNA to cDNA for use in the pyrosequencing PCR was performed as previously described (11, 28).
Optimal primer concentrations were determined for a 50-µl real-time PCR containing 25 µl 2x QuantiTect SYBR green master mix (QIAGEN), 200 nM biotinylated forward primer, 200 nM of reverse primer, and 5 µl cDNA template. Cycling conditions used were 50°C for 2 min, followed by 10 min at 95°C and 40 cycles of 15 s at 94°C and 60 s at 60°C. Amplification and detection were performed using an ABI Prism 7000 real-time thermocycler.
Pyrosequencing was performed according to the manufacturer's protocol (Biotage). In brief, 40 µl of biotinylated PCR product was immobilized onto streptavidin Sepharose High Performance (Amersham Biosciences, Buckinghamshire, United Kingdom) in binding buffer (10 mM Tris-HCl [pH 7.6], 2 M NaCl, 1 mM EDTA, and 0.1% Tween 20) and vigorously shaken for 10 min at room temperature. Sequencing primer (440 nM) in annealing buffer (20 mM Tris-acetate [pH 7.6] and 2 mM MgAc2) was incubated at 80°C for 2 min and then allowed to cool slowly to RT. Single-stranded DNA template was obtained by using the PyroMark vacuum prep workstation (Biotage). Immobilized PCR product was initially washed in 70% ethanol and then incubated in 0.2 M NaOH. A final wash in 10 mM Tris-acetate, pH 7.6, was carried out before annealing single-stranded DNA to the sequencing primer.
Sequencing was performed using an automated PSQ PyroMark ID instrument (Biotage). Substrate and enzyme were dispensed, followed by the sequential addition of nucleotides, in the order CTCTC. Sequence results were obtained in the form of pyrograms and analyzed using IdentiFire software (Biotage).
(ii) Cycle sequencing confirmation analysis. PCR products (amplified by the H5 TaqMan real-time RT-PCR assay from reference H5 viruses) were sequenced by automated nucleotide cycle sequencing. PCR products were first purified using a QIAquick PCR purification kit (QIAGEN Ltd.) and then sequenced using a Beckman Coulter CEQ 2000 capillary sequencer and CEQ 2000 dye terminator cycle sequencing quick-start kit (Beckman Coulter, Fullerton, CA). Nucleotide sequences were compared by BLAST analysis using the influenza sequence database (19) and GenBank sequence database (2).
|
|
|---|
Sensitivity. The sensitivity of the H5-specific TaqMan real-time RT-PCR for the detection of influenza H5 viruses was determined on at least five separate occasions by using 10-fold dilutions (101 to 1012) of three influenza H5 viruses representative of clade 1 (NIBRG14), clade 2 (NIBRG23), and clade 3 (A/Duck/Singapore-Q/F119-3/1997). An analysis of 1 PFU of virus reliably and reproducibly generated CT values of 34.00 ± 0.28.
By using the QuantiTect probe RT-PCR kit, the real-time H5 RT-PCR assay detected <1 PFU of NIBRG14 and A/Duck/Singapore-Q/F119-3/1997 viruses belonging to HA clade 1 and clade 3, respectively, and 1 to 10 PFU of the clade 2 H5 virus NIBRG23. When SuperScript III Platinum one-step RT-PCR master mix was used, the H5 assay detected <1 PFU of the H5 viruses analyzed from clade 1, 2, or 3.
The sensitivity of the real-time H5 assay using cultured H5 viruses spiked into clinical material was also determined on five separate occasions. When NIBRG14 or A/Duck/Singapore-Q/F119-3/1997 viruses were diluted in either VTM or clinical N/T material, the end point of detection observed was <1 PFU of each virus. NIBRG14 and A/Duck/Singapore-Q/F119-3/1997 viruses were also spiked at three different concentrations into influenza virus- and RSV-negative N/T swab, sputum, and human serum samples with 1.6 x 104, 1.6 x 102, and 1.6 PFU of virus analyzed, respectively. Influenza A H5 viral RNA was detected (CT < 38.00) with the H5 TaqMan real-time RT-PCR assay in all of the N/T swab, serum, and sputum samples spiked with the A/Duck/Singapore-Q/F119-3/1997 or NIBRG14 H5 viruses, at all of the virus concentrations analyzed, with the CT values obtained with H5 viruses spiked at the same concentration in different simulated clinical sample types differing by CT values of 0.08 to 1.10.
The applicability of two different widely used extraction procedures for the purification of viral RNA for use in the H5 TaqMan real-time assay was then determined. Serial dilutions of A/Duck/Singapore-Q/F119-3/1997 virus prepared in VTM or negative N/T swab clinical material were extracted in parallel by a GSCN-silica method (4, 28) and a commercial viral RNA purification kit (QIAGEN Ltd.), and purified RNA was analyzed in duplicate with the H5 real-time assay on 10 separate occasions. Using either method, <1 PFU of A/Duck/Singapore-Q/F119-3/1997 virus was reliably detected in the dilutions prepared in VTM (data not shown). Moreover, no difference was observed in the sensitivity of detection of viral RNA purified by either extraction method from A/Duck/Singapore-Q/F119-3/1997 virus spiked in N/T swab clinical material (data not shown).
Specificity. The H5 TaqMan real-time RT-PCR assay was tested for the ability to detect human and avian influenza H5 viruses from different H5 HA clades and subclades (specificity panel A) (Table 1). Amplification was observed with the H5 RT-PCR assay when influenza H5 viruses of avian or human origin (from the H5 HA clades 1, 1', 2, or 3 [33]) were analyzed. The H5 real-time RT-PCR assay was also tested for cross-reactivity with RNA prepared from influenza A virus isolates of subtypes H1 to H15 (specificity panel B), influenza B and C viruses, and other cultured respiratory viruses (specificity panel C) and clinical samples (combined N/T swabs) containing human influenza virus H1 or H3 or influenza B viruses (specificity panel D). No detectable amplification (CT < 38.00) was observed with viral RNA purified from influenza A virus subtypes H1 to H15, with the exception of the H5N3 virus A/Duck/Singapore-Q/F119-3/1997. No detectable amplification (CT < 38.00) was observed following analysis of the respiratory viruses in specificity panel C or the clinical samples containing human influenza H1 or H3 or influenza B viruses (specificity panel D) by the H5 real-time RT-PCR assay, indicating the specificity of the H5 RT-PCR assay for influenza H5 viruses (data not shown).
Confirmatory strategies. (i) H5 real-time RT-PCR restriction enzyme digestion confirmation analysis.
For confirmation of the amplification of WT H5 viral RNA and differentiation of WT from H5 positive control amplicons, a restriction enzyme digestion assay was developed based on nucleotide differences at two sites in the sequence of the respective amplicons. Positive control amplicons were cut following digestion with the enzyme MseI to yield two fragments of 69 and 82 bp (Fig. 2a). Since the MseI recognition site is absent in the DNA sequence of WT-derived PCR products, MseI did not digest these amplicons. The restriction enzyme Taq
I cuts PCR products amplified by the H5 real-time assay from WT H5 HA clade 1 and 2 strains at one site, yielding two fragments of 21 and 130 bp, whereas positive control amplicons were not digested by this enzyme since the Taq
I restriction recognition site is absent (Fig. 2a and b). The avian H5 HA clade 2 virus A/Turkey/Turkey/1/2005 and the genetically modified A/Turkey/Turkey/1/2005 virus (NIBRG23) real-time RT-PCR products were not digested by the MseI or Taq
I restriction enzyme (Fig. 2a and b). An analysis of the H5 HA sequence of A/Turkey/Turkey/1/2005 indicated that a nucleotide substitution (C to T) at position 799, in the region amplified by the H5 real-time RT-PCR assay, resulted in the loss of the Taq
I restriction site. However, amplicons from the other clade 2 H5 viruses analyzed retained the Taq
I restriction site and gave restriction patterns characteristic of clade 2 viruses (Fig. 2b).
![]() View larger version (59K): [in a new window] |
FIG. 2. Restriction enzyme analysis of influenza A H5 HA real-time RT-PCR amplicons. (a) MseI and Taq I digestion of H5 WT (clade 1 and 2) and positive control (clade 3) HA amplicons. In the lane descriptions below, numbers in brackets after strain names refer to H5 HA clades. Lanes 1 and 7, undigested A/Vietnam/1194/2004 (1); lanes 2 and 8, undigested NIBRG23 (2); 3 and 9, undigested A/Duck/Singapore-Q/F119-3/1997 (3); lane 4, MseI-digested A/Vietnam/1194/2004 (1); lane 5, MseI-digested NIBRG23 (2); lane 6, MseI-digested A/Duck/Singapore-Q/F119-3/1997 (3); lane 10; Taq I-digested A/Vietnam/1194/2004 (1); lane 11, Taq I-digested NIBRG23 (2); lane 12, Taq I-digested A/Duck/Singapore-Q/F119-3/1997 (3); lane M, DNA molecular weight markers. (b) Taq I digestion of HA RT-PCR amplicons from WT H5 (clade 2) and positive control (clade 3) viruses. Lane 1, undigested A/Indonesia/5/2005 (2); lane 2, Taq I-digested A/Indonesia/5/2005 (2); lane 3, undigested A/Indonesia/6/2005 (2); lane 4, Taq I-digested A/Indonesia/6/2005 (2); lane 5, undigested A/Turkey/Turkey/1/2005 (2); lane 6, Taq I-digested A/Turkey/Turkey/1/2005 (2); lane 7, undigested A/Q-CageBird/England/1219/2005 (2); lane 8, Taq I-digested A/Q-CageBird/England/1219/2005 (2); lane 9, undigested NIBRG23 (2); lane 10, Taq I-digested NIBRG23 (2); lane 11, undigested A/Duck/Singapore-Q/F119-3/1997 (3); lane 12, Taq I-digested A/Duck/Singapore-Q/F119-3/1997 (3); lane M, DNA molecular weight markers.
|
![]() View larger version (21K): [in a new window] |
FIG. 3. Pyrograms of raw data obtained from pyrosequencing a 5-nucleotide region of HA1 of the HA gene of H5 viruses. The y axis determines the luminescence intensity, with peak heights relative to the number of each nucleotide. The order of enzyme (E), substrate (S), and sequential nucleotide addition is indicated on the x axis. (a) A/Vietnam/1194/2004 (clade 1) sequence CTCTC. (b) NIBRG23 (clade 2) sequence CTCTT. (c) A/Duck/Singapore-Q/F119-3/1997 (clade 3) sequence CCCTC.
|
(iv) Diagnostic testing for influenza H5 in returning travelers. Returning travelers presenting to hospitals in England with influenza-like illness, who were suspected to be harboring avian H5 virus according to the HPA avian H5 virus infection case definition, were managed according to the HPA H5 algorithm (http://www.hpa.org.uk/infections/topics_az/influenza/avian/algorithm.htm). A total of 15 clinical specimens (nose swabs, throat swabs, sputum samples, and nasopharyngeal aspirates) from seven suspected cases of avian H5 virus infection that precisely matched the HPA H5 influenza virus infection case definition were analyzed between October 2004 and April 2006. Nucleic acid was analyzed directly with the H5 TaqMan real-time RT-PCR in parallel with a two-step multiplex RT-PCR for influenza A H1 and H3 viruses, influenza B viruses, RSVA and RSVB and a pan-influenza A virus RT-PCR (11, 28). Influenza H5 viral RNA was not detected in any of the samples analyzed from the suspected H5 cases. However, influenza AH3 viral RNA was detected in samples from four patients by RT-PCR. Where serum was also collected from these patients, serological testing confirmed that there was no evidence of H5 infection (data not shown).
Respiratory samples collected during an H5N1 human outbreak in Europe in 2006 were also analyzed. Of these five samples, three had previously been demonstrated to contain influenza A H5N1 viral RNA when tested by the WHO Collaborating Centre for Reference and Research on Influenza (A. Hay, personal communication). Following analysis, a lung sample and one of four nasopharyngeal specimens examined were shown to contain influenza A H5 viral RNA by the H5 TaqMan real-time RT-PCR.
|
|
|---|
In countries such as the United Kingdom, where H5N1 infections in birds are not endemic, diagnostic testing for H5 avian influenza is most likely to be performed on travelers returning from H5N1-affected regions or on potentially exposed poultry workers. In both instances, there is a necessity for the use of algorithms to provide robust differential diagnosis. For poultry workers, exposure to avian influenza A viruses of subtypes other than H5 should also be considered.
The H5 real-time RT-PCR described in this report was designed as a one-step, real-time assay to improve efficient processing and reduce the risk of carryover contamination. The H5 assay was designed for use on a TaqMan sequence detection platform (Applied Biosystems); however, the test will be useful in a range of laboratories since the assay is transferable to other real-time platforms, such as the Roche LightCycler, Corbett Rotor-Gene, or Cepheid Smart Cycler, with little reoptimization. Primers that fit the criteria for suitable real-time PCR primers were selected from highly conserved regions of the HA gene of H5 influenza viruses, with the range limited by the high rate of variation in the gene. In addition, the probe sequence selection from a highly conserved region was aided by the use of the minor groove binder at the 3' end of the probe, which increased the melting temperature of the probe, allowing the use of shorter probes. Despite the selection of conserved regions, in order to ensure the amplification of target viral RNA from the HA gene of influenza viruses belonging to all three H5 HA clades, three degenerate bases were incorporated into the forward primer and one was incorporated into the probe sequence. The influenza A H5N3 virus A/Duck/Singapore-Q/F119-3/1997 was selected as the positive control material for the real-time RT-PCR assay, since this strain is representative of H5 clade 3 viruses, which have not been detected since 1997, and can easily be distinguished genetically from H5 circulating viruses of clade 1 and clade 2. False-positive results arising from the contamination of test samples by the positive control can therefore be confirmed by sequence-dependent confirmatory assays. In addition, A/Duck/Singapore-Q/F119-3/1997 virus has the advantage of being apathogenic and can be easily cultured at CL2. While this is a useful strategy, it does not discriminate from cross-contamination of WT from other specimens, so in the event of a positive signal, it is important to reconfirm the result by reextraction at a time of low prevalence.
The H5 TaqMan real-time RT-PCR assay was shown to be extremely sensitive for the detection of influenza A H5 viruses, detecting clade 1, 2, and 3 H5 virus levels of 1 PFU or less by using a QuantiTect Probe RT-PCR master mix (QIAGEN Ltd.). Furthermore, when a different commercially available one-step RT-PCR master mix was used (Superscript III Platinum RT-PCR kit; Invitrogen), it was observed that the H5 real-time assay was 1 log more sensitive for the detection of NIBRG23 (A/Turkey/Turkey/1/2005) clade 2 virus, detecting <1 PFU of this virus. This was also seen with the A/Chicken/Turkiye/Av05/2006 clade 2 virus, but not with the other clade 2 viruses analyzed from Table 1 (data not shown). An examination of the sequence of the H5 assay target region of A/Turkey/Turkey/1/2005 and A/Chicken/Turkiye/Av05/2006 identified three mismatches relative to the primer and probe sequences that were not present in the HA sequences of the other clade 2 viruses analyzed or in those of clade 1, 1', or clade 3 H5 viruses: nucleotide 16 in the forward primer (C to A, degenerate in the primer), nucleotide 7 in the reverse primer (C to T), and nucleotide 14 in the probe (T to A, degenerate in the probe). Differences in the composition of the two RT-PCR master mixes, including magnesium ion concentration, reverse transcriptase, and polymerase enzymes, could have resulted in a greater tolerance of the mismatches between the target sequence and primers/probe. It is therefore essential to use the Superscript III Platinum real-time master mix in this H5 RT-PCR assay to ensure optimum sensitivity of detection of H5 viruses belonging to all H5 HA clades and subclades.
It is vital that diagnostic assays are highly sensitive for the diagnosis of H5N1 infection using different clinical sample types. The pattern of replication of influenza H5N1 viruses in the human respiratory tract is unclear, and it may be appropriate to analyze various clinical samples. Efficient replication of H5N1 viruses has been demonstrated in cells in the lower region of the respiratory tract, where the avian virus receptor (SA
2,3Gal) is prevalent (26, 32), and more recently, the infection of nasopharyngeal and oropharyngeal epithelial cells as well as lung tissue has been demonstrated (22).The sensitivity of the H5 real-time assay for different clinical sample types, such as secretions from the upper respiratory tract and lower respiratory tract, was analyzed in this study first by using simulated respiratory clinical H5 samples due to the limited availability of H5 clinical samples from human cases and also by analysis of a small number of respiratory samples from suspect H5 cases during an H5N1 human outbreak in Europe in 2006. The study demonstrated that the H5 real-time RT-PCR assay is suitable for analyzing both upper respiratory and lower respiratory tract samples.
Serum samples spiked with H5 viruses were also analyzed since invasive H5N1 infection has been documented for mammals and humans (9, 13, 14, 35). Previously reported RT-PCR assays for the detection of H5 viruses have been designed to detect human and avian clade 3 viruses, human clade 1' viruses, or clade 1 human, avian, and felid viruses from 1997, 2003, and 2004, respectively (20, 21, 24), and have not included validation data on the detection of H5 clade 2 viruses. It is particularly important that the sensitivity and specificity for clade 2 viruses are determined for any potentially useful diagnostic H5 assay, since clade 2 viruses are becoming geographically more widespread and the predominant H5 strain isolated from humans and birds. The H5 real-time RT-PCR described here was shown to be specific for the detection of influenza A H5 viruses, amplifying viral RNA from viruses belonging to all of the H5 HA clades and subclades identified since 1997. Nonreactivity of the H5 real-time RT-PCR assay with other influenza A virus subtypes, influenza B and C viruses, and noninfluenza respiratory viruses was demonstrated, confirming the specificity of the assay for H5 viruses.
The majority of published assays for the detection of H5 viruses have relied on detection in a single assay (20, 24). In contrast, in this report, the incorporation of a distinguishable H5-positive assay control and confirmatory assay options enable the verification of the integrity of positive results.
For diagnostic laboratories that do not have access to sequencing facilities, a simple restriction enzyme digest assay was developed. The selection of the two restriction sites chosen was based on differences in the HA sequence of the H5 real-time assay amplicons between clade 1, 1', and 2 viruses, compared to the sequence from the clade 3 positive control PCR product. Positive control amplicons have the MseI restriction site, which is absent in amplicons from WT viruses. In contrast, the enzyme Taq
I digests PCR products from H5 clade 1 and 2 viruses, whereas positive control-derived amplicons are not digested since the Taq
I site is absent. During the study, it was observed that the Taq
I restriction site has been lost from a subclade of H5 clade 2 viruses, demonstrating the importance of using at least two different enzymes for the confirmatory analysis. Confirmation of the amplification of a clade 2 subclade 2 virus requires sequence analysis of the real-time RT-PCR amplicon by traditional nucleotide sequencing or confirmation with the RT-PCR pyrosequencing assay. The restriction digest assay is easy to perform, and the confirmatory assay can be performed in 3.5 h. A confirmation of H5 diagnosis with the H5 real-time RT-PCR can be also be achieved by direct sequencing of the PCR amplicon, since the sequence of the H5 amplicon generated by amplification from WT viruses is distinguishable from that of the H5N3-positive control virus. Sequence confirmation can be achieved in 5 to 6 h following diagnosis with the H5 real-time RT-PCR assay.
Pyrosequencing of RT-PCR amplicons has previously been used to genotype viruses (1, 10), and although pyrosequencing has been utilized to assess adamantane resistance among influenza A strains (6), there have been no reports to date of the applicability of pyrosequencing to genotype influenza viruses. The pyrosequencing RT-PCR was designed to amplify a region of the HA gene that is distinguishable between H5 viruses belonging to the different H5 HA clades. The results demonstrated that the pyrosequencing assay was reproducible and easy to interpret and that confirmation was achieved more rapidly than with standard nucleotide cycle sequencing, with results available 2.25 h after H5 diagnosis with the real-time RT-PCR assay.
The application of the H5 real-time RT-PCR to the diagnosis of H5 infection in upper respiratory tract and lower respiratory tract secretions from suspected cases presenting in the United Kingdom was analyzed. Although no positive cases were detected, the diagnosis of influenza A H3N2 virus infection in 57% of cases analyzed highlights the importance of differential diagnosis for suspected avian influenza virus infection patients, particularly for travelers returning from regions where seasonal influenza viruses may be circulating.
In the design of this H5 real-time RT-PCR, an alignment of conserved regions of influenza A H5 viruses was made with publicly available sequences. The restriction PCR digest and pyrosequencing confirmatory assays were also designed based on the viral HA gene sequences. Due to the high mutation frequency of influenza viruses and the heterogeneity of the circulating strains, it is theoretically possible that mutations in the primer or probe regions or the regions used for confirmation may occur and continual analysis of sequences from recently circulating strains must be performed. The addition of an internal control would further improve the assay as a diagnostic tool, as each sample would be checked for the quality of the nucleic acid extraction.
Published ahead of print on 14 March 2007. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»