JCM Figure table search 04
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
JCM.02392-06v1
45/6/1889    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zou, S.
Right arrow Articles by Shu, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zou, S.
Right arrow Articles by Shu, Y.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, June 2007, p. 1889-1892, Vol. 45, No. 6
0095-1137/07/$08.00+0     doi:10.1128/JCM.02392-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Human Influenza A Virus (H5N1) Detection by a Novel Multiplex PCR Typing Method{triangledown}

Shumei Zou,1 Jian Han,2 Leying Wen,1 Yan Liu,3 Kassi Cronin,2 Shanjuan H. Lum,2 Lu Gao,2 Jie Dong,1 Ye Zhang,1 Yuanji Guo,1 and Yuelong Shu1*

Chinese Center for Disease Control and Prevention, National Institute for Viral Disease Control and Prevention, State Key Laboratory of Infectious Disease Control and Prevention, Beijing, People's Republic of China,1 Genaco Biomedical Products, Inc., Huntsville, Alabama,2 Anhui Provincial Center for Disease Control and Prevention, Hefei, People's Republic of China3

Received 28 November 2006/ Returned for modification 19 January 2007/ Accepted 2 March 2007


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We report the use of ResPlex III for genotyping influenza A viruses. The performance characteristics of the assay with regard to H5N1 are further evaluated. The ResPlex system incorporates a novel multiplex PCR technology, target-enriched multiplex PCR, to simultaneously amplify multiple molecular targets in one reaction. The ResPlex III assay targets the H1, H2, H3, H5, H7, H9, N1, and N2 genes from the influenza A virus as well as the NS genes from influenza A (NSA) and B (NSB) viruses, providing detection and genotyping of influenza A and B viruses. The analytical sensitivities for detecting the H5, N1, and NSA genes were 1, 10–1, and 10 50% tissue culture infectious doses/200 µl/reaction, respectively. A total of 217 sequential clinical samples including 14 samples with human H5N1 infections were tested by the ResPlex III assay, and the results were compared to a reference standard combined with results of viral culture and conventional reverse transcriptase and real-time PCR. The clinical sensitivity and specificity for detecting H5N1 were 93.3% and 100%, respectively, indicating that different subtypes of influenza A virus can be quickly and correctly identified using the ResPlex III genotyping approach.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Since 1997, the H5N1 subtype of influenza A virus has been circulating in Asia, and now in European countries, causing widespread infection in multiple avian species. So far, human-to-human transmission has been suspected in only one case. If an outbreak of H5N1 occurs in humans, millions of people worldwide may die from the pandemic. Limited amounts of effective vaccines and drug treatments make the prevention and control of this disease difficult. Thus, the most effective measure for containing a potential outbreak is a large-scale quarantine of suspected patients.

To minimize the social and economic impact of a large-scale quarantine measure, a quick, accurate, and comprehensive diagnostic system is essential. Current diagnostic methods, such as culture, immunoassays, and PCR-based molecular tests, lack the ability to meet this challenge. We believe that an ideal diagnostic test for avian influenza virus pandemic surveillance and outbreak control should satisfy the following requirements: (i) high throughput, which allows the analysis of hundreds, even thousands, of samples per day; (ii) multiplex, to detect multiple relevant molecular targets using only one patient sample, conducting one experiment, in one reaction system; (iii) safety, to minimize the risk to health care providers by inactivating pathogens at the beginning of the test procedure; (iv) accuracy, to provide validated assay specificity and sensitivity; (v) speed (the entire procedure, from sample collection to result output, takes less than 5 h); and (vi) ease of use, to automate assay procedures, making it possible to quickly establish a surveillance laboratory network without extensive training. The U.S. Food and Drug Administration has approved a real-time PCR assay for the identification of influenza A/H5 virus (Asian lineage). This diagnostic test, developed by the U.S. Centers of Disease Control and Prevention, was intended to be used in public health laboratory networks for the surveillance of H5N1 outbreaks (2). In this study, we report the development of the ResPlex III multiplex PCR assay for influenza A virus typing analysis. The analytical and clinical sensitivity and specificity of the assay were evaluated with regard to the H5N1 virus (Asian lineage).


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Patient samples and viral isolates. One important function of our National Influenza Center at the Chinese Centers for Disease Control (CDC) is to monitor outbreaks of influenza virus by collaborating with established provincial surveillance laboratories and testing samples submitted to us from provincial laboratories. From October 2005 to February 2006, The Chinese CDC received a total of 217 human respiratory samples from 16 provinces (AnHui, Liaoning, XinJiang, GuangXi, HeBei, JiangXi, FuJIan, XiZang, HuNan, ShanDong, SiChuan, JiLin, GuiZhou, HuBei, and GuangDong) to rule out avian influenza virus (H5N1). The majority of clinical samples were pharyngeal swabs (83%) or tracheal aspirates (17%). Samples were collected in 0.9% NaCl and shipped to Beijing at 4°C via express mail within 24 h of collection. If not shipped immediately, samples were kept frozen at or below –70°C until shipping. Upon arrival, if the culture was being set up immediately, the samples were stored at 4°C; otherwise, samples were stored at or below –70°C. Viral isolation and culture were performed according to WHO guidelines (WHO/CDS/CSR/NCS/2002.5 Rev. 1; http://www.who.int/csr/resources/publications/influenza/whocdscsrncs20025.pdf). All samples were investigated with multiple methods, including viral culture, reverse transcriptase PCR (RT-PCR), and real-time PCR.

One human H5N1viral isolate, A/Anhui/1/2005, was used for analytical sensitivity studies. The 50% tissue culture infectious dose (TCID50) for this isolate was determined using a standard viral culture method (4). Briefly, viral isolates harvested from chicken embryo cultures were serially diluted in quadruplicate and added onto an MDCK (Madin-Darby canine kidney) cell monolayer in log-phase growth. The TCID50 was determined according to a method described previously by Reed and Muench (7).

Determination of analytical sensitivity. The viral isolate (A/Anhui/1/2005) with a known TCID50 was serially diluted in phosphate-buffered saline. At each concentration, three samples were prepared. Nucleic acid isolation was performed on each sample, and samples were then subjected to amplification with the ResPlex III method. The analytical sensitivity was determined to be the lowest TCID50 at which all three duplicated samples were successfully detected.

Nucleic acid isolation and amplification with RT-PCR and real-time PCR. A QIAGEN QIAamp Viral RNA Mini kit (Valencia, CA) was used for the extraction of nucleic acid from all of the samples. The starting material for nucleic acid isolation was 200 µl of a respiratory sample (in 0.9% NaCl) or 200 µl viral isolate in dilution buffer (phosphate-buffered saline). RNA was eluted into 50 µl water.

Reference standard setup. Even though the ResPlex III assay can provide genotyping information for many influenza A virus strains, the most important intended use of this assay is to identify influenza A H5N1 virus (Asian lineage) as a confirmatory test. To evaluate the performance of ResPlex III in this regard, a reference standard was established to represent the combined results of the viral culture, RT-PCR, and real-time PCR. A sample was determined to be positive for H5N1 when at least two of the three reference methods were positive. For ResPlex III, a sample was determined to be positive for H5N1 only when all three targets (H5, N1, and NSA) were positive.

Conventional RT-PCR and real-time PCR. We have reported the development of RT-PCR and real-time PCR assays for the detection of H5N1 from human clinical specimens (9). The primer sequences used for these studies are as follows: RT-PCR primers were H5HA-F (GCCATTCCACAACATACACCC), H5HA-R (CTCCCCTGCTCATTGCTATG), N1-F (TTGCTTGGTCAGCAAGTGC), and N1-R (CAGTCACACCATTTGGATCC); real-time PCR primers were FluA-F (GACCRATCCTGTCACCTCTGAC), FluA-R (GGGCATTYTGGACAAAKCGTCTACG) FluA-p (TGCAGTCCTCGCTCACTGGGCACG), H5HA-F (TGGAAAGTGTAARAAACGGAACGT), H5HA-R (TGATTGCCAGYGCTAGGGAACT), and H5HA-p (TGACTACCCGCAGTATTCAGAAGAAGCAAGACTAA).

Amplification and detection with target-enriched multiplex PCR (tem-PCR). The analytical sensitivity of ResPlex III was evaluated with viral isolate strain A/Anhui/1/2005, which was established from a patient sample from Anhui Province (8). The TCID50 were determined as described previously (4). Multiplex target amplification was carried out using the ResPlex III assay system from Genaco (Huntsville, AL) (catalog no. 011-03). The SuperPrimers from the assay system contain a mixture of specific primers capable of amplifying the hemagglutinin gene from subtypes H1, H2, H3, H5, H7, and H9 as well as the neuraminidase gene from the N1 and N2 subtypes. Amplification targets for the NS gene of influenza virus types A and B are also included in the mixture. The QIAGEN OneStep RT-PCR kit (Valencia, CA) was the enzyme and buffer system used for amplification. To set up the amplification reaction, 5 to 20 µl RNA template was mixed with 2 µl RT-PCR enzyme, 6 µl ResPlex III SuperPrimers, 2 µl deoxynucleoside triphosphate mix, 10 µl 5x RT-PCR buffer, 5 to 10 units of RNase inhibitor, and RNase-free water to bring the final volume to 50 µl. Reverse transcription and amplification were carried out in a one-step reaction with a GeneAmp PCR system 9700 (Applied Biosystems) by using the specific cycling profile described in the Genaco protocol. A nontarget amplification control was included in each experiment.

After PCR amplification, 5 µl PCR product was directly mixed with 35 µl of Genaco detection buffer and 10 µl of Genaco ResPlex III bead mix. Hybridization was carried out at 52°C for 10 min. For detection, 10 µl of diluted streptavidin-phycoerythrin was added followed by an additional 5-min incubation at 52°C. Finally, 120 µl of prewarmed Genaco stopping buffer was added to the sample prior to detection on a Luminex instrument. The Luminex xMAP technology was described elsewhere previously (3).


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Figure 1 shows representative results of a ResPlex III analysis. Each column represents a specific target, and each row represents a sample. The first 20 samples (samples 1 to 20) were clinical samples, including 14 human H5N1 samples identified by the reference methods. Samples 21 to 31 were not clinical samples but were viral isolates. These samples were used to evaluate the usefulness of ResPlex III in detecting other H and N targets. The last three samples (samples 32 to 34) were blanks without any template in the reaction. The median fluorescent intensity of each target from these three blank samples represented the background. The cutoff values for determining the positive signal were determined specifically for each target. The cutoffs were calculated as the mean median fluorescent intensity plus four times the standard deviation of the blank samples. Positive results are indicated in Fig. 1.


Figure 1
View larger version (66K):
[in this window]
[in a new window]

 
FIG. 1. Representative results of ResPlex III genotyping analysis.

 
Table 1 shows the analytical sensitivity of the ResPlex III assay. The analytical sensitivity was then determined by using serially diluted viral stocks. As shown in Table 1, the analytical sensitivity for H5, N1, and influenza A virus type-specific NS genes are 1 TCID50, 10–1 TCID50, and 10 TCID50, respectively, per reaction mixture.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Analytical sensitivity of the ResPlex III assay for detecting H5N1 genotypes

 
Table 2 shows the performance characteristics of the ResPlex III assay by comparing it against the reference standard. A total of 217 clinical samples were sent to the Chinese CDC during the study period and were included in the study. Among them, the reference methods identified 14 human H5N1-positive samples, while the ResPlex III assay identified 13 samples as being positive for H5N1. The assay's sensitivity, specificity, positive predictive value, and negative predictive value were calculated to be 93.3%, 100%, 100%, and 99.5%, respectively.


View this table:
[in this window]
[in a new window]

 
TABLE 2. Performance of ResPlex III assay compared with the reference standard for detecting H5N1

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
For the 13 H5N1-positive clinical samples identified by the ResPlex III assay (Fig. 1 and Table 2), positive results were also obtained by both the RT-PCR and real-time PCR assays. Viral isolation, on the other hand, failed in 3 of the 14 cases. Sample CnCDC4 was positive for the N1 and NSA target but negative for H5. Sequence analysis showed that a 1-bp mutation occurred at the 3' end of the inside reverse primer for the H5 gene. This result suggested that the ResPlex III assay is vulnerable to viral mutations, even though primers were designed by selecting conserved sequences. To reduce false-negative results, we need to monitor the viral mutations closely and add new primers and probes to adapt to the changes. Alternatively, the ResPlex III assay should amplify more than one target from the H5 gene to provide additional assurance and reduce false-negative results.

The principle of tem-PCR technology was described previously (1, 5, 6). Conventional multiplex PCR assays are difficult to develop because of three primary problems: incompatible primer sets, high background amplification, and poor reproducibility. The tem-PCR technology developed by Genaco successfully addresses these problems, improving and expanding the possibilities for multiplex PCR assay development.

For each target in the multiplex PCR, nested gene-specific primers were designed and included in the reaction (Fo [forward out], Fi [forward in], Ri [reverse in], and Ro [reverse out]). These primers are used at extremely low concentrations and are used only to enrich the targets during the first few cycles of PCR. The inside gene-specific primers have tag sequences that can be recognized by a universal set of primers, called SuperPrimers. Only the SuperPrimers are included at a concentration necessary for exponential amplification, and only the reverse SuperPrimer is labeled with biotin. Labeled PCR products are detected with a complementary capture probe that is covalently coupled to a color-coded bead. The concentration of the reverse SuperPrimer is higher than that of the forward SuperPrimer; the asymmetric PCR yields more reverse strand for detection. This also eliminated the need to denature PCR products prior to hybridization.

tem-PCR works because it addresses three of the most difficult problems inherent in multiplex PCR development. First, in a conventional multiplex PCR, each primer may require a different optimal annealing temperature or buffer formula. When the number of targets increases, it forces all of the primer sets to work under a single amplification profile, causing multiplex PCR to become difficult under these standardized conditions. With tem-PCR, during the enrichment stage, nested primers are used for each target. This design gives rise to four possible forward and reverse primer combinations for amplification. Each combination may have its own optimum amplification profile, but given four amplification opportunities, a common condition satisfying all targets can be attained.

Second, conventional multiplex PCR uses multiple sets of high-concentration, labeled primers. These primers can associate with one another to form dimers or generate nonspecific background amplification. Reduced amplification efficiency can also occur because excess primers occupy active sites on the polymerase molecule. In addition, unused, labeled primers produce background signal and use up reagents during the detection portion of the assay. Because of these issues, post-PCR cleanup (such as spin column purification) is often required to remove these labeled primers before the products can be used as probes. These problems are unnecessary, because high-concentration primers are required only for the last cycles of a PCR. With tem-PCR, the amount of gene-specific primers used is only enough to "enrich" the targets and incorporate the SuperPrimer tag into the products. After enrichment and tag incorporation, exponential amplification is carried out with only one pair of primers. Because only one primer is labeled, the background is low; therefore, no post-PCR cleanup is required. tem-PCR is also very specific and sensitive. No posthybridization washes are necessary. These features make it feasible to fully automate laboratory procedures and perform high-throughput clinical studies.

Finally, a conventional multiplex PCR product is difficult to produce. Maintaining the quality of all biotin-labeled primers in a mix is a difficult task. Lot-to-lot variations often limit the performance of a multiplex reaction and require repeated optimization and adjustment. With tem-PCR, only a small amount of target-specific primers is used, and only one biotin-labeled primer is included; therefore, lot-to-lot variations are small, and quality control is more manageable.

The ResPlex III assay uses the Luminex instrument for detecting PCR products. The hybridization step requires the opening of PCR tubes and mixing PCR products with the bead mix. This step is prone to carryover contamination, and strict preventive procedures need to be established.

We have evaluated the performance of the ResPlex III assay using viral isolates and clinical samples. The assay is very easy to use and rapid. Up to 96 samples can be processed together. The test turnaround time is about 5 h, starting from sample preparation to obtaining the results, and the hands-on time is less than 1 h. We believe that the ResPlex III assay can be used as a medium-throughput confirmative test for those samples suspected to be H5N1 (Asian lineage).


    ACKNOWLEDGMENTS
 
This work was supported by a Chinese National Nature and Science Foundation key program grant (30599433).

We are grateful for the support from the Chinese Influenza/Human Avian Influenza Surveillance Network.


    FOOTNOTES
 
* Corresponding author. Mailing address: China National Influenza Center, Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, Yingxin Jie 100, Xuanwu District, Beijing 10052, People's Republic of China. Phone and Fax: 86-10-6357-7499. E-mail: yshu{at}vip.sina.com Back

{triangledown} Published ahead of print on 14 March 2007. Back


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Brunstein, J., and E. Thomas. 2006. Direct screening of clinical specimens for multiple respiratory pathogens using the Genaco respiratory panels I & II. Diagn. Mol. Pathol. 15:169-173.[CrossRef][Medline]
  2. Centers for Disease Control and Prevention. 2006. New laboratory assay for diagnostic testing of avian influenza A/H5 (Asian lineage). Morb. Mortal. Wkly. Rep. 55:127.[Medline]
  3. Dunbar, S. A., C. A. Vander Zee, K. G. Oliver, K. L. Karem, and J. W. Jacobson. 2003. Quantitative, multiplexed detection of bacterial pathogens: DNA and protein applications of the Luminex LabMap system. J. Microbiol. Methods 53:245-252.[CrossRef][Medline]
  4. Guo, Y. J., and X. W. Cheng. 1997. Laboratory techniques for influenza studies. SanXia Publishing, Beijing, People's Republic of China.
  5. Han, J. 2006. Molecular differential diagnoses of infectious diseases: is the future now? In C. Stratton and Y. W. Tang (ed.), Advanced technologies in diagnostic microbiology. Springer Publishing Company, New York, NY.
  6. Han, J., D. C. Swan, S. J. Smith, S. H. Lum, S. E. Sefers, E. R. Unger, and Y. W. Tang. 2006. Simultaneous amplification and identification of 25 human papillomavirus types with Templex technology. J. Clin. Microbiol. 44:4157-4162.[Abstract/Free Full Text]
  7. Reed, L. J., and H. Muench. 1938. A simple method of estimating fifty percent endpoints. Am. J. Hyg. 27:493-497.
  8. Shu, Y. L., H. J. Yu, and D. X. Li. 2006. Lethal avian influenza A (H5N1) infection in a pregnant woman in Anhui Province, China. N. Engl. J. Med. 354:1421-1422.[Free Full Text]
  9. Wen, L. Y., H. Xu, Y. Lan, X. Zhao, X. G. Zhang, D. Y. Wang, L. H. Yao, J. Dong, J. H. Zhang, Y. J. Guo, and Y. L. Shu. 2006. Development of methods for detection of H5N1 from human clinical specimens. Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi 20:24-26. (In Chinese.)


Journal of Clinical Microbiology, June 2007, p. 1889-1892, Vol. 45, No. 6
0095-1137/07/$08.00+0     doi:10.1128/JCM.02392-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
JCM.02392-06v1
45/6/1889    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zou, S.
Right arrow Articles by Shu, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zou, S.
Right arrow Articles by Shu, Y.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Antimicrob. Agents Chemother. Clin. Microbiol. Rev.
Clin. Vaccine Immunol. ALL ASM JOURNALS