JCM Figure table search 04
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
JCM.00104-07v1
45/6/2002    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bidet, P.
Right arrow Articles by Bingen, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bidet, P.
Right arrow Articles by Bingen, E.
Journal of Clinical Microbiology, June 2007, p. 2002-2004, Vol. 45, No. 6
0095-1137/07/$08.00+0     doi:10.1128/JCM.00104-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Molecular Epidemiology of the sil Streptococcal Invasive Locus in Group A Streptococci Causing Invasive Infections in French Children{triangledown}

Philippe Bidet, Céline Courroux, Christophe Salgueiro, Agnès Carol, Patricia Mariani-Kurkdjian, Stéphane Bonacorsi, and Edouard Bingen*

Université Paris VII, UFR Médicale; EA 3105, Laboratoire d'Études de Génétique Bactérienne dans les Infections de l'Enfant; Assistance Publique-Hôpitaux de Paris (AP-HP), Service de Microbiologie, Laboratoire associé au CNR des Streptocoques-Infections à Streptocoque du groupe A de l'Enfant, Hôpital Robert Debré, Paris, France

Received 15 January 2007/ Returned for modification 22 February 2007/ Accepted 12 March 2007


    ABSTRACT
 Top
 ABSTRACT
 TEXT
 REFERENCES
 
We found 31 different emm-toxin genotypes among 74 group A streptococcal isolates causing invasive infections in French children. The predominant emm types were emm1 (25%), emm3 (8%), emm4 (8%), emm6 (7%), and emm89 (9%). Sixteen percent of isolates harbored the streptococcal invasive locus, half of them belonging to emm4.


    TEXT
 Top
 ABSTRACT
 TEXT
 REFERENCES
 
Group A streptococci (GAS) cause a wide range of invasive diseases, such as necrotizing fasciitis, streptococcal toxic shock syndrome, bacteremia, and meningitis (5). The recent increase in invasive GAS disease has been linked to the worldwide spread of two clones belonging to serotypes M1 and M3 (4, 6, 17, 19). However, several studies have failed to link invasive GAS disease to a particular serotype or virulence gene, suggesting that all GAS strains may cause severe infection in susceptible hosts (15, 18).

Hidalgo-Grass et al. discovered a DNA locus named sil (Streptococcus invasive locus) harbored by a highly virulent clone of serotype M14 causing necrotizing fasciitis in Israel, and they showed that it was involved in the virulence of these strains in an animal model (10). However, M14 strains are rarely encountered in North America and Europe (13, 15, 18, 21). In order to analyze the prevalence of this DNA locus among GAS isolates in France, we performed an epidemiological study of GAS strains causing invasive infections in French children based on emm genotyping, PCR of pyrogenic exotoxin genes, and PCR detection and sequencing of the sil locus.

We studied a collection of 74 GAS isolates causing invasive infections in French children (aged 3 months to 15 years) between 1999 and 2006 (46 blood isolates, 4 cerebrospinal fluid isolates, 6 pleural isolates, 10 cellulitis isolates, 2 osteomyelitis isolates, 2 arthritis isolates, and 4 throat isolates associated with toxic shock syndrome). The reference strain MGAS8232 (M18) was used as a control for sil PCR. All strains were cultured on blood agar plates and were stored at –80°C until characterization. emm sequence typing was performed as described by Beall et al. (1) on the CDC web site (http://www.cdc.gov/ncidod/biotech/strep/protocol_emm-type.htm). DNA was extracted with a commercial Chelex resin-based DNA extraction kit (InstaGene Matrix; Bio-Rad, France) as recommended by the manufacturer. Multiplex PCR was used for toxin gene profiling (speA, speB, speC, ssa, and smeZ) as described by Schmitz et al. (18). PCR detection of the sil locus was performed with two sets of primers: silC-F (ATATCTCCACCAATCACTTTAAGTA) and silC-R (ACTATAAAGATAAGATACTCAACAGT) for the silC open reading frame (ORF) (amplification product of 189 bp) as well as silD-F (GATGAAGTTCGTCAAGCTGACT) and silD-R (TCGGCTATAGCGATACGTTTAATC) for the silD ORF (amplification product of 148 bp). All PCR mixes consisted of a 50-µl volume with 25 µl of 2x QIAGEN Multiple PCR Master Mix (Courtaboeuf, France), 5 µl of 5x Q-solution, 1 µM each primer, and 5 µl of bacterial DNA extract. PCR was performed with a Bio-Rad iCycler thermal cycler as follows: DNA denaturation and polymerase activation for 15 min at 95°C; 30 cycles of 30 s at 94°C, 90 s at 55°C, and 90 s at 72°C; and a final extension step for 10 min at 72°C. For DNA sequencing of three emm4 clinical isolates, the silC-F and silD-R primers were used to amplify a 1,110-bp DNA stretch encompassing the silC and silD ORFs (GenomeExpress, Meylan, France). The sequences were compared to those of strains MGAS8232 (M18), MGAS10750 (M4), and J95 (M14) by using the BLAST algorithm (NCBI) and ClustalW program (20).

The 74 isolates comprised 24 different emm types and 31 different virulence genotypes (Table 1). The predominant emm types were emm1 (25%), emm3 (8%), emm4 (8%), emm6 (7%), and emm89 (9%). None of the isolates was emm14 (M14 serotype), but PCR was positive for silC and silD in 12 isolates (16%). The sil locus was restricted to a few emm types (emm4, emm29, emm74, emm77, emm87, emm102, and emm122); the majority of isolates harboring the sil locus belonged to emm4, corresponding to serotype M4 (n = 6; 50% of the sil-positive isolates). Sequencing of a 1,110-bp DNA stretch of the sil locus encompassing the silC and silD ORFs in three emm4 strains revealed that the start codon of the silCR ORF that encodes the GAS bacterial pheromone (spy450 in strain MGAS8232) was present. The sequences obtained were identical to that of the newly sequenced genome of serotype M4 strain MGAS10750 (2). Comparison of the sil loci in the representative strains of the three serotypes (M4, M14, and M18) revealed that the silC ORF, although not highlighted in the genome annotations, was present in the three strains and had the same deduced amino acid sequence. In M18 and M4 strains, contrary to the M14 strain, the start codon of the bacterial pheromone ORF silCR was present and the silD ORF coding for a putative ABC transporter was truncated (Fig. 1). The interruption of silD was due to a frameshift generated by the deletion of an adenine at position 472 of the silD ORF in MGAS8232 (M18) and to the replacement of CTCAAA by TTTAG at positions 436 to 441 of the silD ORF in the M4 strains.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Prevalence of the different virulence genotypes among 74 French invasive pediatric GAS isolates

 

Figure 1
View larger version (15K):
[in this window]
[in a new window]

 
FIG. 1. Comparison of the sil loci in the three reference strains J95 (M14), MGAS8232 (M18), and MGAS10750 (M4). Each ORF is represented by a broad arrow and a number or gene name. The hatched arrow represents the inactivated silCR ORF in J95 (corresponding to ORF 540 in MGAS8232 and ORF 405 in MGAS10750). The gray arrows represent the potential silC coding sequence in MGAS8232 and MGAS10750. Below each ORF, the annotation is given if it differs from the hypothetical protein.

 
The respective roles of host and bacterial factors in GAS invasive diseases are difficult to unravel. Although some invasive clones of serotype M1 and M3 have been identified worldwide (4, 6, 17, 19), many epidemiological studies have failed to find significant differences in serotype or toxin production between GAS isolates causing mild versus invasive disease (15, 18). Kotb et al. showed that some HLA class II alleles were associated with a higher risk of streptococcal toxic shock syndrome (14). Thus, invasive GAS disease may result from a combination of a GAS clone with a particular genotype and a specific susceptible host background. However, some GAS clones may possess other, unknown virulence traits specifically associated with invasiveness.

Hidalgo-Grass et al. identified a DNA locus named sil in the invasive serotype M14 clone causing necrotizing fasciitis in Israel (10). Within the sil locus, an ORF named silC, of unknown function, was found to be involved in mouse virulence after signature-tagged mutagenesis of strain J95 (M14). The sil locus is absent from serotype M1 and M3 strains, which are associated with GAS invasive diseases worldwide and have been wholly sequenced (3, 8). In the reference strain of serotype M18 (MGAS8232), this locus is present but differs from the M14 strain sil locus by a frameshift within the silD ORF and by the presence of a silCR ORF, lacking in M14 strains, that encodes a pheromone peptide involved in decreased interleukin-8 proteolysis (9). Although displaying high virulence in the animal model, few invasive isolates in North America and Europe are M14 (13, 15, 18, 21). However, the sil locus, complete or truncated, might be present in other GAS clones circulating in Europe. We therefore analyzed the prevalence of this locus in GAS strains causing invasive disease in French children with respect to their toxin profile and emm genotype.

None of our 74 invasive isolates belonged to serotype M14, but 16% harbored the sil locus. The sil locus was detected in 7 out of 24 emm types found in the collection (29%), and 50% of sil-positive isolates belonged to emm type 4 (serotype M4). Sequencing of the sil locus in these M4 strains revealed that the start codon of the silCR ORF that encodes the GAS bacterial pheromone was present. The sequences we obtained were identical to that of the newly sequenced genome of MGAS10750, also belonging to serotype M4 (2). The virulence-associated silC ORF, although not highlighted in the genome annotations of strains MGAS10750 and MGAS8232, was present in both strains. However, they both differed from strain M14 by the presence of the bacterial pheromone gene silCR and by a frameshift in the silD ORF that encodes a putative ABC transporter. In a recent study, Eran et al. have demonstrated that SilCR, exported by the SilD/E ABC transporter, suppresses silC transcription (7). The disruption of the silD ORF could thus prevent the correct expression and functionality of the SilCR signaling and promote silC-mediated virulence in M4 strains. In this latter study the sil locus was present in 28% of the strains, a higher rate of presence probably reflecting the difference in serotype prevalence between France and Israel (16), but SilCR was not always produced in these strains (7).

Further studies are needed to determine the involvement of the sil locus in the virulence of M4 strains. Indeed, M4 strains account for 6% of the invasive strains in our collection, and M4 is one of the main serotypes encountered worldwide among strains causing invasive disease (11, 13, 15, 21). A recent candidate vaccine based on M protein failed to elicit antibodies to serotype M4 (12), and sil-encoded proteins might represent alternative vaccine targets for this serotype.


    ACKNOWLEDGMENTS
 
We thank the microbiologists and the pediatricians who sent us the GAS strains.


    FOOTNOTES
 
* Corresponding author. Mailing address: Service de Microbiologie, Hôpital Robert Debré, 48 Bd Sérurier, 75395 Paris cedex 19, France. Phone: 33 1 40 03 23 40. Fax: 33 1 40 03 24 50. E-mail: edouard.bingen{at}rdb.ap-hop-paris.fr Back

{triangledown} Published ahead of print on 21 March 2007. Back


    REFERENCES
 Top
 ABSTRACT
 TEXT
 REFERENCES
 

  1. Beall, B., R. Facklam, and T. Thompson. 1996. Sequencing emm-specific PCR products for routine and accurate typing of group A streptococci. J. Clin. Microbiol. 34:953-958.[Abstract]
  2. Beres, S. B., E. W. Richter, M. J. Nagiec, P. Sumby, S. F. Porcella, F. R. DeLeo, and J. M. Musser. 2006. Molecular genetic anatomy of inter- and intraserotype variation in the human bacterial pathogen group A Streptococcus. Proc. Natl. Acad. Sci. USA 103:7059-7064.[Abstract/Free Full Text]
  3. Beres, S. B., G. L. Sylva, K. D. Barbian, B. Lei, J. S. Hoff, N. D. Mammarella, M. Y. Liu, J. C. Smoot, S. F. Porcella, L. D. Parkins, D. S. Campbell, T. M. Smith, J. K. McCormick, D. Y. Leung, P. M. Schlievert, and J. M. Musser. 2002. Genome sequence of a serotype M3 strain of group A Streptococcus: phage-encoded toxins, the high-virulence phenotype, and clone emergence. Proc. Natl. Acad. Sci. USA 99:10078-10083.[Abstract/Free Full Text]
  4. Cleary, P. P., E. L. Kaplan, J. P. Handley, A. Wlazlo, M. H. Kim, A. R. Hauser, and P. M. Schlievert. 1992. Clonal basis for resurgence of serious Streptococcus pyogenes disease in the 1980s. Lancet 339:518-521.[CrossRef][Medline]
  5. Cunningham, M. W. 2000. Pathogenesis of group A streptococcal infections. Clin. Microbiol. Rev. 13:470-511.[Abstract/Free Full Text]
  6. Efstratiou, A. 2000. Group A streptococci in the 1990s. J. Antimicrob. Chemother. 45:3-12.[Abstract]
  7. Eran, Y., Y. Getter, M. Baruch, I. Belotserkovsky, G. Padalon, I. Mishalian, A. Podbielski, B. Kreikemeyer, and E. Hanski. 2007. Transcriptional regulation of the sil locus by the SilCR signalling peptide and its implications on group A streptococcus virulence. Mol. Microbiol. 63:1209-1222.[CrossRef][Medline]
  8. Ferretti, J. J., W. M. McShan, D. Ajdic, D. J. Savic, G. Savic, K. Lyon, C. Primeaux, S. Sezate, A. N. Suvorov, S. Kenton, H. S. Lai, S. P. Lin, Y. Qian, H. G. Jia, F. Z. Najar, Q. Ren, H. Zhu, L. Song, J. White, X. Yuan, S. W. Clifton, B. A. Roe, and R. McLaughlin. 2001. Complete genome sequence of an M1 strain of Streptococcus pyogenes. Proc. Natl. Acad. Sci. USA 98:4658-4663.[Abstract/Free Full Text]
  9. Hidalgo-Grass, C., M. Dan-Goor, A. Maly, Y. Eran, L. A. Kwinn, V. Nizet, M. Ravins, J. Jaffe, A. Peyser, A. E. Moses, and E. Hanski. 2004. Effect of a bacterial pheromone peptide on host chemokine degradation in group A streptococcal necrotising soft-tissue infections. Lancet 363:696-703.[CrossRef][Medline]
  10. Hidalgo-Grass, C., M. Ravins, M. Dan-Goor, J. Jaffe, A. E. Moses, and E. Hanski. 2002. A locus of group A Streptococcus involved in invasive disease and DNA transfer. Mol. Microbiol. 46:87-99.[CrossRef][Medline]
  11. Ho, P. L., D. R. Johnson, A. W. Yue, D. N. Tsang, T. L. Que, B. Beall, and E. L. Kaplan. 2003. Epidemiologic analysis of invasive and noninvasive group a streptococcal isolates in Hong Kong. J. Clin. Microbiol. 41:937-942.[Abstract/Free Full Text]
  12. Hu, M. C., M. A. Walls, S. D. Stroop, M. A. Reddish, B. Beall, and J. B. Dale. 2002. Immunogenicity of a 26-valent group A streptococcal vaccine. Infect. Immun. 70:2171-2177.[Abstract/Free Full Text]
  13. Johnson, D. R., E. L. Kaplan, A. VanGheem, R. R. Facklam, and B. Beall. 2006. Characterization of group A streptococci (Streptococcus pyogenes): correlation of M-protein and emm-gene type with T-protein agglutination pattern and serum opacity factor. J. Med. Microbiol. 55:157-164.[Abstract/Free Full Text]
  14. Kotb, M., A. Norrby-Teglund, A. McGeer, H. El-Sherbini, M. T. Dorak, A. Khurshid, K. Green, J. Peeples, J. Wade, G. Thomson, B. Schwartz, and D. E. Low. 2002. An immunogenetic and molecular basis for differences in outcomes of invasive group A streptococcal infections. Nat. Med. 8:1398-1404.[CrossRef][Medline]
  15. McMillan, D. J., R. G. Beiko, R. Geffers, J. Buer, L. M. Schouls, B. J. Vlaminckx, W. J. Wannet, K. S. Sriprakash, and G. S. Chhatwal. 2006. Genes for the majority of group A streptococcal virulence factors and extracellular surface proteins do not confer an increased propensity to cause invasive disease. Clin. Infect. Dis. 43:884-891.[CrossRef][Medline]
  16. Moses, A. E., C. Hidalgo-Grass, M. Dan-Goor, J. Jaffe, I. Shetzigovsky, M. Ravins, Z. Korenman, R. Cohen-Poradosu, and R. Nir-Paz. 2003. emm typing of M nontypeable invasive group A streptococcal isolates in Israel. J. Clin. Microbiol. 41:4655-4659.[Abstract/Free Full Text]
  17. Musser, J. M., V. Kapur, J. Szeto, X. Pan, D. S. Swanson, and D. R. Martin. 1995. Genetic diversity and relationships among Streptococcus pyogenes strains expressing serotype M1 protein: recent intercontinental spread of a subclone causing episodes of invasive disease. Infect. Immun. 63:994-1003.[Abstract]
  18. Schmitz, F. J., A. Beyer, E. Charpentier, B. H. Normark, M. Schade, A. C. Fluit, D. Hafner, and R. Novak. 2003. Toxin-gene profile heterogeneity among endemic invasive European group A streptococcal isolates. J. Infect. Dis. 188:1578-1586.[CrossRef][Medline]
  19. Stromberg, A., V. Romanus, and L. G. Burman. 1991. Outbreak of group A streptococcal bacteremia in Sweden: an epidemiologic and clinical study. J. Infect. Dis. 164:595-598.[Medline]
  20. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680.[Abstract/Free Full Text]
  21. Vlaminckx, B., W. van Pelt, L. Schouls, A. van Silfhout, C. Elzenaar, E. Mascini, J. Verhoef, and J. Schellekens. 2004. Epidemiological features of invasive and noninvasive group A streptococcal disease in the Netherlands, 1992-1996. Eur. J. Clin. Microbiol. Infect. Dis. 23:434-444.[CrossRef][Medline]


Journal of Clinical Microbiology, June 2007, p. 2002-2004, Vol. 45, No. 6
0095-1137/07/$08.00+0     doi:10.1128/JCM.00104-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
JCM.00104-07v1
45/6/2002    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bidet, P.
Right arrow Articles by Bingen, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bidet, P.
Right arrow Articles by Bingen, E.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Antimicrob. Agents Chemother. Clin. Microbiol. Rev.
Clin. Vaccine Immunol. ALL ASM JOURNALS