Erratum for Stewart et al., J. Clin. Microbiol. 43 (11) 5574-5580.
This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stewart, M.
Right arrow Articles by Wilcox, G.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Stewart, M.
Right arrow Articles by Wilcox, G.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, June 2007, p. 2100, Vol. 45, No. 6
0095-1137/07/$08.00+0     doi:10.1128/JCM.00644-07

ERRATUM

TaqMan Real-Time Reverse Transcription-PCR and JDVp26 Antigen Capture Enzyme-Linked Immunosorbent Assay To Quantify Jembrana Disease Virus Load during the Acute Phase of In Vivo Infection

Meredith Stewart, Moira Desport, Nining Hartaningsih, and Graham Wilcox

School of Veterinary and Biomedical Science, Murdoch University, Murdoch, WA 6150, Australia; State Agricultural Biotechnology Centre, Murdoch University, Murdoch, WA 6150, Australia; and Disease Investigation Centre, BPPH Wilayah VI, P.O. Box 3322, Denpasar, Indonesia 802233

Volume 43, no. 11, p. 5574-5578, 2005. Page 5574, abstract, line 5: "pol" should read "gag."

Page 5575, column 1, line 36: "The primer set JDV pol1f (GGGAGACCCGTCAGATGTGGA; Invitrogen, Australia) and JDV pol1r (TGGGAAGCATGGACAATCAG; Invitrogen) specifically amplified 121 bp in JDV pol" should read "The primer set JDV gag1f (TGGGAAGCATGGACAATCA; Invitrogen) and JDV gag1r (GGAGACCCGTCAGATGTGGA; Invitrogen) specifically amplified 118 bp in JDV gag."

Page 5575, column 1, line 44: "pol" should read "gag."

Page 5575, column 1, line 63: "pol" should read "gag."

Page 5576, column 1, line 12: "pol" should read "gag."

Page 5576, column 1, line 14: "pol" should read "gag."

Page 5576, column 1, line 16: "pol" should read "gag."

Page 5576, column 2, line 5: "pol" should read "gag."

Page 5578, Figure 6 legend, line 4: "pol" should read "gag."

Journal of Clinical Microbiology, June 2007, p. 2100, Vol. 45, No. 6
0095-1137/07/$08.00+0     doi:10.1128/JCM.00644-07





This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stewart, M.
Right arrow Articles by Wilcox, G.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Stewart, M.
Right arrow Articles by Wilcox, G.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»