Previous Article | Next Article 
Journal of Clinical Microbiology, August 2007, p. 2570-2574, Vol. 45, No. 8
0095-1137/07/$08.00+0 doi:10.1128/JCM.00647-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
Nuclease-Resistant Single-Stranded DNA Controls for Nucleic Acid Amplification Assays
Antje Gotsch,
Andreas Schubert,
Armin Bombis,
Michael Wiedmann,
Michael Zauke, and
Stefan Schorling*
Roche Diagnostics GmbH, Penzberg, Germany
Received 23 March 2007/
Returned for modification 4 May 2007/
Accepted 24 May 2007
 |
ABSTRACT
|
|---|
Molecular diagnostic tests based on the PCR or alternative nucleic acid amplification technologies are commonly used for pathogen screening at blood drawing centers. Contrived process surveillance using test-specific external and internal controls is critical for the efficient leverage of PCR power. We describe here novel control constructs for use in nucleic acid amplification assays for pathogens with a single-stranded DNA genome, e.g., parvovirus B19. These controls are derived from a deletion mutant of the filamentous phage fd-tet, fKN16, and consist of single-stranded DNA packaged in a protein coat. They are essentially noninfectious to Escherichia coli and highly resistant to nuclease degradation. fKN16 based controls can be readily manufactured and highly purified. Despite their confirmed filamentous morphology, they can be precisely and accurately diluted over a wide range. Stability studies reveal that the novel control constructs are highly resistant to temperature stress, regardless of whether they are tested as concentrated stocks in storage buffer or diluted in buffer or human plasma. Real-time amplification curves derived from recombinant control constructs containing a parvovirus B19 specific sequence fragment match those derived from native virus. In summary, our data demonstrate the feasibility of novel nuclease-resistant single-stranded DNA controls as surrogates for parvovirus B19 and their applicability in routine molecular diagnostics.
 |
INTRODUCTION
|
|---|
Implementation of nucleic acid testing at blood-drawing centers has been driven by the requirement to detect human immunodeficiency virus and hepatitis C virus in human plasma before seroconversion, i.e., before the development of target-specific antibodies. Over the last decade continuous effort to improve transfusion and blood product manufacturing safety has transformed the quality of diagnostic PCR screening for these pathogens. A key to this development has been the introduction of armored, i.e., RNase-resistant, RNA as a control for efficient surveillance of the whole workflow, including nucleic acid extraction, amplification, and detection (9, 14). The main advantage of armored over conventional naked RNA is that it can be added directly to samples. As an internal control (IC) or a positive control (PC), armored RNA can thus be used to monitor pathogen lysis and nucleic acid purification efficiency, as well as for PCR inhibition.
In a similar approach, a chimeric viral sequence was cloned into a lambda bacteriophage to generate nuclease-resistant double-stranded DNA (12). The intention was to use it as an IC in real-time PCR screening for herpesvirus and hepatitis B virus. This new construct is superior to unprotected plasmid DNA IC in its storage and handling properties and also enables lysis efficiency to be monitored during sample preparation. However, there are concerns that this lambda phage-based control is unstable in human plasma and still infective to bacteria. Since marked stability in human plasma is a critical prerequisite in any PC, lambda phage control technology requires further improvement before it can fully exploit the potential of nuclease-resistant DNA (13).
In contrast to herpesvirus and HBV, parvovirus B19 (B19V) is a small nonenveloped virus with a single-stranded instead of double-stranded DNA genome. Infection with the virus usually occurs during childhood via the respiratory route causing mild fifth disease (erythema infectiosum). B19V primoinfection in adults may be more severe, with arthropathy or transient aplastic crisis. Fetal infection following placental transfer may cause hydrops fetalis or intrauterine death (reviewed in reference 17). High prevalence means that B19V is often present in, and transmissible via, blood and blood products (2, 5, 6, 10, 16). PCR assays for this pathogen have therefore been implemented in routine blood screening and quality control of blood product manufacturing (1, 3).
From a technical point of view, the single-stranded DNA character of the B19V genome has implications for the design of full process controls. PCs and ICs of nucleic acid purification and amplification efficiency need to behave identically to the target if they are to flag process failures. Critical determinants of nucleic acid behavior during sample preparation are size, secondary structure, and charge (7). In addition, especially during the early cycles of real-time PCR, primer and probe hybridization site accessibility is a key to amplification and detection efficiency. Such accessibility is greatly determined by the secondary structure of the target nucleic acid. A double-stranded DNA control clearly cannot mimic single-stranded DNA properties such as charge and secondary structure. We therefore conceived a new control concept combining single-stranded DNA with the physical and biochemical stability of armored RNA. We report the development of a nuclease-resistant single-stranded DNA (nrssDNA) derived from a deletion mutant of the filamentous phage fd-tet, fKN16 (8).
 |
MATERIALS AND METHODS
|
|---|
Cloning of nrssDNA-B19V-PC and nrssDNA-B19V-QS expression strains.
A B19V DNA-positive human plasma research sample was used to amplify B19V NS1 spanning a region from nucleotide 2044 to 2193 (numbered according to isolate M13178) by standard PCR methods. Forward primer AG01 (5'-TATAAGCTTGAAACCCCGCGCTCTAGTACGCCCAT-3') and reverse primer AG02 (5'-TATAAGCTTCCCAACTAACAGTTCACGAA-3') were designed with a 5' HindIII cleavage site (underlined) for further cloning. The resulting amplicon was subcloned into pCR-Blunt II-TOPO according to the instruction manual (Zero Blunt TOPO PCR cloning kit; Invitrogen, Carlsbad, CA) and transformed into OneShot Top10 chemically competent Escherichia coli. Transformants were analyzed by colony PCR (Mastercycler gradient; Eppendorf, Hamburg, Germany) using the primer pair AG01-AG02. Positive clone plasmids were prepared (QIAprep Spin miniprep kit; QIAGEN, Hilden, Germany), and the inserts were sequenced by M13 primer-based sequence analysis (Sequiserve, Vaterstetten, Germany). Cloning into fKN16 phage vector was performed essentially as described previously (8). In brief, B19V inserts were cut out of recovered pCR-Blunt II-TOPO vector by HindIII digest (Roche Applied Science, Mannheim, Germany). The digest products were separated by agarose gel electrophoresis and the B19V insert migrating at approximately 150 bp was purified from the gel (MinElute gel extraction kit; QIAGEN). fKN16 phage vector (ATCC 37002) was transformed into chemically competent E. coli K802 (ATCC 33526), and plasmid DNA was prepared from 100 ml of a K802
fKN16 culture grown in 2xYT medium (Roth, Karlsruhe, Germany) supplemented with 20 µg of tetracycline (Roche Applied Science)/ml. fKN16 plasmid was linearized with HindIII, dephosphorylated using shrimp alkaline phosphatase (Roche Applied Science), and purified by using a High Pure PCR template purification kit (Roche Applied Science) for subsequent ligation (T4 DNA ligase; Roche Applied Science) with the HindIII-cut B19V insert. The ligation reaction was transformed into chemically competent E. coli K802 and plated onto LB agar supplemented with 20 µg of tetracycline/ml. Plasmids were prepared from colony PCR-positive clones, and the sequence was verified by sequence analysis as described above. One plasmid was designated fKN16-B19V-PC and retransformed into K802 to generate the nrssDNA-B19V-PC expression strain. Plasmid fKN16-B19V-QS was generated by a similar process, except that the target probe binding sequence was changed by standard molecular biology techniques to allow hybridization to the B19V-QS probe sequence (see below). fKN16-B19V-QS was accordingly retransformed into K802 to generate the nrssDNA-B19V-QS expression strain. B19V-related sequence inserts of both plasmids are shown in Table 1.
nrssDNA-B19V-PC and nrssDNA-B19V-QS production and purification were based on an online resource (www.biosci.missouri.edu/smithgp/PhageDisplayWebsite/VirionPurification.doc; large scale purification of fd-tet-derived virions using Sarkosyl [accessed December 2005]). In brief, an nrssDNA-B19V-PC/-QS expression strain starter culture (20 ml 2xYT medium, 20 µg of tetracycline/ml) grown overnight to log phase was used to inoculate (1% [vol/vol]) 1 liter of the same medium. The culture was incubated at 37°C for 18 h under 180 rpm agitation to an optical density at 600 nm of approximately 3.5. nrssDNA was separated from E. coli cells by two successive centrifugation steps at 6,000 x g at 4°C for 20 min using a fixed-angle rotor. The nrssDNA-containing supernatant was supplemented with a 1/10 volume of 5 M NaCl solution (Merck, Darmstadt, Germany); a 1/20 volume of PEG 8000 (46% [wt/wt]) (Sigma-Aldrich, Buchs, Switzerland) was added, and the solution was gently mixed and incubated at 4°C for 16 to 18 h to allow nrssDNA precipitation. nrssDNA was separated from the supernatant by centrifugation at 10,000 x g and 4°C for 30 min (Sorvall RC5B Plus; rotor HB-6) and resuspended in 8 ml of TBS (25 mM Tris, 500 mM NaCl [pH 7.5]; Bio-Rad, Hercules, CA). The nrssDNA solution was cleared by final centrifugation at 12,000 x g and 4°C for 30 min (Sorvall RC5B Plus; rotor HB-6) before purification. Final purification of nrssDNA was done by CsCl gradient ultracentrifugation. An 8-ml volume of nrssDNA-TBS solution was adjusted to a final CsCl concentration of 31% (wt/wt) with solid CsCl (USB, Cleveland, Ohio), mixed gently until the salt fully dissolved, and centrifuged at 235,000 x g at 15°C for 40 h (Discovery 90SE; rotor, Sorvall TV 865). The two bands visible in the centrifugation tube, plus the region in between (middle band), were removed separately using an 18-gauge needle and diluted 1:1,000 in TBS (25 mM Tris [Sigma-Aldrich, Buchs, Germany], 50 mM NaCl [Merck, Darmstadt, Germany], 0.09% [wt/vol] NaN3 [Acros Organics, Geel, Belgium]; pH 7.5) for further analysis.
The final nrssDNA concentration was calculated by using the equation: virions/ml = (A269 – A320) x 6E16/number of bases per virion (www.biosci.missouri.edu/smithgp/PhageDisplayWebsite/AbsorptionSpectrum.doc) (Absorption spectroscopy and quantitation of filamentous phage; accessed December 2005).
B19V real-time PCR assay was performed as follows. Generic nucleic acid purification from the sample was automated on the COBAS AmpliPrep instrument as previously described (11), with slight modifications. For amplification, a primer set similar to that for the cloning procedures was used, omitting the HindIII cleavage sites, i.e., the forward primer (5'-GAAACCCCGCGCTCTAGTAC-3') and the reverse primer (5'-CCCAACTAACAGTTCACGAA-3'). The target probe was 5'-(FAM)TCCCCGGGACCAGTTCAGGAGAATCATTTGTCGGAAG(BHQ2)-3' and the QS probe was 5'-(HEX)TGGACTCAGTCCTCTGGTCATCTCACCTTCT(BHQ2)-3' to distinguish between B19V target and B19V QS. The TaqMan Generic RNA amplification kit (Roche Molecular Systems, Branchburg, NJ) was used as the master mix supplemented with 7% (vol/vol) dimethyl sulfoxide and 2.75 mM manganese acetate (final concentration). For amplification and detection on the COBAS TaqMan analyzer (Roche Instrument Center, Rotkreuz, Switzerland), a recently described PCR profile (15) was used.
DNase I resistance assay.
A total of 10 µl of nrssDNA-B19V-QS solution (1E12 copies/ml; i.e., 1 x 1012) was supplemented with DNase I (2 U, 10 µl of 10x DNase incubation; Roche Applied Science) and incubated for 10 min at 37°C. After enzyme inactivation for 10 min at 70°C, the samples were diluted 1:10,000 in ICQS diluent and subjected to real-time PCR analysis as described above, omitting the sample preparation step. ssDNA extracted from the nrssDNA-B19V-QS was used as a control.
Infectivity assay.
For this assay, 1.5 ml of an E. coli XL1-Blue MRF' kanamycin (Stratagene, La Jolla, CA) overnight culture (10 ml of imMedia kanamycin liquid [Invitrogen]) was supplemented with either 10 µl of nrssDNA-B19V-PC or 10 µl of nrssDNA-B19V-QS stock solution (1E12 copies/ml each) and incubated at 37°C for 2 h of 130-rpm agitation to permit potential infection. To screen for infected cells, a 20-µl portion of each sample was plated on LB-tetracycline or LB-kanamycin, followed by incubation at room temperature for 68 h.
Stability assay.
For analysis of concentrated stock stability, nrssDNA-B19V-PC was diluted to a final concentration of 1E11 copies/ml in storage buffer (25 mM Tris, 50 mM NaCl, 0.09% [wt/vol] NaN3; pH 7.5), and 100-µl aliquots in 1.5-ml screw cap reaction tubes incubated at 4, 37, or 45°C. The nrssDNA-B19V-PC stock was then diluted 1:1,000,000 in EDTA plasma and subjected to real-time PCR analysis. To analyze nrssDNA stability diluted in buffer, nrssDNA-B19V-QS was diluted 1:10,000 in ICQS diluent [10 mM Tris, 0.1 mM EDTA, 0.05% (wt/vol) NaN3, 20 µg of poly(rA)/ml (pH 8.1)], and 10-ml aliquots in 25-ml screw-cap bottles were incubated at 4, 37, or 45°C. Testing was done straight without further dilution. nrssDNA-B19V-PC was diluted 1:2,000,000 in normalized human plasma (NHP; Seracare, Milford, MA), divided into aliquots at 1.2 ml in 1.5-ml screw-cap reaction tubes, and stored at 4, 37, or 45°C while awaiting real-time PCR analysis. Based on the Arrhenius equation, this temperature stress model assumed that the stability at 37°C for "x" weeks equals the stability at 2 to 8°C for 8x weeks and that stability at 45°C for "y" weeks equals the stability at 2 to 8°C for 16y weeks.
Electron microscopy.
A drop of appropriately diluted sample was placed on a 400-mesh carbon-coated copper grid, freshly hydrophilized by glow discharge. After incubation for 2 min, the drop was quickly removed with a Pasteur pipette, and the grid was air dried before being stained with 2% uranium acetate and 0.01% glucose, washed with a drop of water, and air dried again. Micrographs were taken with an EM 912 electron microscope (Zeiss, Oberkochen, Germany) equipped with an integrated OMEGA energy filter operated at 100 kV in zero-loss mode.
 |
RESULTS AND DISCUSSION
|
|---|
The filamentous phage family has been well known for many years; f1, fd, and M13 are its most prominent representatives. They are very similar to each other and differ only by a few nucleotides. Today, M13 and derivatives are mainly used as cloning vectors for sequence propagation and in various phage display techniques. When looking for the most appropriate candidate to develop nrssDNA, we were drawn to the fd-tet mutant fKN16 (8) for several reasons: the phage contains a single-stranded DNA genome, it is released in high amounts from E. coli cells, and it is noninfective to bacteria but transfers tetracycline resistance as a selection marker. The latter two arguments are especially important in simplifying and standardizing manufacturing procedures.
Growth and purification of nrssDNA.
The original fKN16 sequence was derived from the American Type Culture Collection and used to clone nrssDNA-B19V-PC and nrssDNA-B19V-QS as described above (Table 1). During production and purification of nrssDNA, serial process samples were taken for analysis. After the nrssDNA expression strains were grown for approximately 15 h, the yield plateaued, as demonstrated by real-time PCR analysis (data not shown). To standardize further studies, harvesting was set at 18 h after inoculation. To confirm that the expression strains secreted nrssDNA into the supernatant, electron micrographs were taken of resolubilized PEG/NaCl precipitates of both, i.e., the nrssDNA-B19V-PC and nrssDNA-B19V-QS expression strain supernatants, along with that of the original fKN16 strain as a reference (Fig. 1). The images clearly demonstrate the filamentous shape of nrssDNA. Nor did the morphology of the genetically modified nrssDNA-B19V-PC and nrssDNA-B19V-QS appear to differ from the original fKN16. The nrssDNA purification method was then optimized as described above. After CsCl gradient ultracentrifugation, nrssDNA purity in the upper, middle, and lower bands and the previous resolubilized PEG/NaCl precipitate was determined by spectrophotometry (Fig. 2). Except for the lower band, all samples were reactive for the presence of B19V target DNA (data not shown). However, compared to the other samples, the scan showed slight shifting of the upper band peak to the far end, i.e., 269 nm, the reported absorption maximum of filamentous phages (see Materials and Methods). It can therefore be assumed that after CsCl gradient ultracentrifugation the upper band largely consists of enriched nrssDNA, whereas the middle band is probably a mixture of nrssDNA and ssDNA. Enzyme-linked immunosorbent assay for E. coli proteins demonstrated that the enriched nrssDNA was largely depleted of expression strains proteins (data not shown). The yield was 1E14 to 5E14 copies of nrssDNA/liter expression culture, using the Smith lab equation cited above. In summary, the optimized growth and purification method we have described here is a robust procedure for manufacturing high-yield highly enriched nrssDNA.

View larger version (102K):
[in this window]
[in a new window]
|
FIG. 1. Electron micrographs of nrssDNA. fKN16 (A), nrssDNA-B19V-QS (B), and nrssDNA-B19V-PC (C) were expressed as described in the text, and supernatants were precipitated with polyethylene glycol-NaCl. Pellets were resuspended in low-salt buffer and prepared for electron microscopy.
|
|

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 2. Spectrophotometry of nrssDNA samples taken at different purification steps. Line 2, resolubilized nrssDNA PEG-NaCl precipitate. Lines 1, 3, and 4 represent the upper, middle, and lower bands, respectively, that resulted from CsCl gradient ultracentrifugation. Rhombi, absorption maxima.
|
|
nrssDNA is essentially noninfective to E. coli.
It has been reported that fKN16 is noninfective to bacteria due to a deletion of the N-terminal domain of the gIII protein (4, 8). We sought to confirm that the molecular cloning procedures used to generate the nrssDNA-B19V-PC and nrssDNA-B19V-QS expression strains did not alter this important property. Enriched nrssDNA after PEG/NaCl precipitation was incubated with fd-tet-sensitive E. coli in suspension, and the mixture plated onto LB plates supplemented with tetracycline and onto nonselective LB plates as a reference. As a negative control, nrssDNA was incubated in the absence of E. coli and E. coli in the absence of nrssDNA. After 68 h of incubation at room temperature, the colonies were counted. In the absence of nrssDNA, no colonies formed on the tetracycline plates, whereas the viable cell count on the nonselective plates exceeded 500. In the presence of nrssDNA, the colony count on tetracycline plates was 2 to 6 in the infection assays and the respective negative control, whereas the viable cell reference count again exceeded 500 per plate. This demonstrates that nrssDNA fails to convert E. coli to tetracycline resistance. It can therefore be concluded that nrssDNA is essentially noninfective to E. coli, with a theoretical maximum infectivity rate of 1.5 to 2.25 x 10–8 (E-08).
nrssDNA is resistant to DNase I treatment.
Full-process nucleic acid testing (NAT) controls are designed to monitor the efficiency of nucleic acid purification, amplification, and detection. If control recovery is outside the defined acceptance criteria the reaction or run is invalid. Controls must be able to tolerate a variety of stressors if they are to yield robust results. In the case of controls mixed with biological fluids such as plasma, resistance to ubiquitous nucleases is critical. To test the assumption of nuclease resistance, nrssDNA-B19V-QS was incubated in the presence or absence of DNase I. The control experiment demonstrated naked ssDNA extracted from nrssDNA to be sensitive against DNase I treatment, as shown by the threshold cycle (CT) shift of approximately 17 in the absence or presence of DNase I (data not shown). Assuming a PCR efficiency of near 100%, ssDNA copies decreased by 5 logs, indicating a digest efficiency exceeding 99.99%. In contrast, nrssDNA-B19V-QS showed the same CT values regardless of whether the sample was pretreated with DNase I or not. This led us to conclude that nrssDNA is made nuclease resistant by its protective protein coat. Although the assay only used DNase I, it is compelling to assume that the protein coat serves as a protective barrier against all nucleic acid modifying enzymes that may be present in biological fluids.
nrssDNA is highly stable.
In the routine NAT laboratory, streamlined workflow is essential for standardization, simplification, and operating-cost containment. Ready-to-use PCs are usually manufactured in batches, divided into aliquots, and stored until use. In the preceding experiment, we showed that nrssDNA resists treatment by nucleases due to its protective protein coat. However, proteinases may also be present in human plasma, leading us to stress the possibility that enzymatic hydrolysis of the nrssDNA protein coat during storage could leave the ssDNA open to degradation by nucleases. In order to gain insight into nrssDNA storage stability, we subjected nrssDNA-B19V-PC and nrssDNA-B19V-QS to thermal stress and tested nucleic acid recovery (Table 2): nrssDNA-B19V-PC diluted in NHP gave very stable CT values after storage for at least 4 weeks at 37 and 45°C, equivalent to stabilities at 2 to 8°C of 32 and 64 weeks based on the Arrhenius equation. When incubated concentrated at 1E11 copies/ml in TBS, the CT value increased by approximately 1 after 1 week regardless of whether the samples were stored at low or high temperature. The same observation was made with nrssDNA-B19V-QS in ICQS diluent. However, after 1 week all CT values plateaued, demonstrating that the nrssDNA remains stable with no further decrease in signal recovery. There are at least two explanations for this transient response. First, misassembled or fragmented nrssDNA could be less nuclease resistant, leading to initial ssDNA degradation. Arguments against this hypothesis are that the buffer diluents were nuclease free and that the degradation kinetics were the same at low and high temperatures (Table 2). Second, some of the nrssDNA may have clotted and sedimented or adhered to the storage bottle wall, thus reducing the availability of free nrssDNA. Adhesion is a particularly tempting explanation because it is consistent with the negligible effect observed with dilution in a high-protein-containing solution, e.g., human plasma, when the bottle wall is presumably already saturated with serum protein. In summary, these accelerated stability studies demonstrate marked nrssDNA stability in human plasma and buffered systems for at least 32 weeks at 2 to 8°C.
nrssDNA-B19V-PC can be diluted over a wide linear range.
NAT systems designed to quantify the target nucleic acid require PCs with a defined titer at the lower and upper limit of the linear range to validate their results. Robust and reproducible manufacture of such controls depends on the dilution linearity of the construct. We therefore evaluated the dilution linearity of nrssDNA-B19V-PC in human plasma, starting from a stock with 1E11 copies/ml. Diluted nrssDNA-B19V-PC was tested in replicates of seven in the same real-time PCR assay as described above, calibrated against the World Health Organization standard (Table 3) . Two important observations were made. First, the coefficient of variation (CV) of calculated titers within a series of replicates was very low, indicating that the dilution at a given titer of nrssDNA-B19V-PC was homogeneous. Only one datum point showed an approximate doubling of the mean (Table 3, asterisk). Theoretically, this outlier could be explained either by the presence of a nrssDNA-B19V-PC clot in the control dilution or by a slight deviation in the PCR. Conclusive explanation requires further study. The second observation was that recalculation of the nrssDNA-B19V-PC stock titer in international units based on the mean of replicate testings also showed a low coefficient of variation. Taken together, these data clearly demonstrate that nrssDNA can be diluted accurately and linearly over a wide range.
View this table:
[in this window]
[in a new window]
|
TABLE 3. Quantification of nrssDNA-B19V-PC dilution series in normalized human plasma by using an in-house B19V real-time PCR assay
|
|
nrssDNA-B19V-PC growth curves resemble those of native virus.
A basic PC function is to monitor test process validity. If results are to be reliable, PC constructs must mimic the properties of target native virus. Since the nrssDNA-B19V-PC shares the same target sequence as native B19V, the logical approach to testing the similarity assumption was to compare the real-time PCR growth curves. We therefore diluted a native B19V sample (11) and nrssDNA-B19V-PC in B19V DNA-negative EDTA plasma to a concentration of approximately 1E4 IU/ml and performed real-time PCR analysis as described above. The resulting real-time PCR growth curves closely resemble each other, in CT value, signal gain, and slope (data not shown). Hence, nrssDNA-B19V-PC is a fully competent surrogate for native virus and can be used in routine NAT-based assays.
In summary, we have developed novel control constructs for use in NAT assays for pathogens with a single-stranded DNA genome, e.g., parvovirus B19. These controls are superior to current methodologies such as the use of lambda phage or plasmid-derived controls since they closely resemble the properties of the viral genome and are highly resistant to nuclease-mediated degradation. In addition, nrssDNA controls comprise a pronounced stability and are noninfectious to humans as well as to bacteria. Depending on the cloned probe binding sequence, nrssDNA may be used as a PC or IC to aid in the detection or diagnosis of parvovirus B19 infection.
 |
ACKNOWLEDGMENTS
|
|---|
We are grateful to Andrea Haggenmueller for excellent technical assistance and Gerhard Wanner for the electron micrographs.
 |
FOOTNOTES
|
|---|
* Corresponding author. Mailing address: Roche Diagnostics GmbH, Nonnenwald 2, 82372 Penzberg, Germany. Phone: 49 8856 607852. Fax: 49 8856 604572. E-mail: stefan.schorling{at}roche.com 
Published ahead of print on 6 June 2007. 
 |
REFERENCES
|
|---|
- Allain, J. P., I. Thomas, and S. Sauleda. 2002. Nucleic acid testing for emerging viral infections. Transfusion Med. 12:275-283.[CrossRef][Medline]
- Blümel, J., I. Schmidt, W. Effenberger, H. Seitz, H. Willkommen, H. H. Brackmann, J. Löwer, and A. M. Eis-Hübinger. 2002. Parvovirus B19 transmission by heat-treated clotting factor concentrates. Transfusion 42:1473-1481.[CrossRef][Medline]
- Brown, K. E. 2004. Detection and quantitation of parvovirus B19. J. Clin. Virol. 31:1-4.[Medline]
- Crissman, J. W., and G. P. Smith. 1984. Gene-III protein of filamentous phages: evidence for a carboxyl-terminal domain with a role in morphogenesis. Virology 132:445-455.[CrossRef][Medline]
- Hayakawa, F., K. Imada, M. Towatari, and H. Saito. 2002. Life-threatening human parvovirus B19 infection transmitted by intravenous immune globulin. Br. J. Haematol. 118:1187-1189.[CrossRef][Medline]
- Lynch, T. 1999. Human parvovirus B19 transmission from SD plasma. FDA/CBER/Blood Products Advisory Committee, 63rd Meeting, vol. 1. Food and Drug Administration, Washington, DC.
- Melzak, K., C. S. Sherwood, R. S. B. Turner, and C. A. Haynes. 1996. Driving forces for DNA adsorption to silica in perchlorate solutions. J. Colloid Interface Sci. 181:635-644.[CrossRef]
- Nelson, F. K., S. M. Friedman, and G. P. Smith. 1981. Filamentous phage DNA cloning vectors: a noninfective mutant with a nonpolar deletion in gene III. Virology 108:338-350.[CrossRef][Medline]
- Pasloske, B. L., C. R. WalkerPeach, R. D. Obermoeller, M. Winkler, and D. B. DuBois. 1998. Armored RNA technology for production of ribonuclease-resistant viral RNA controls and standards. J. Clin. Microbiol. 36:3590-3594.[Abstract/Free Full Text]
- Saldanha, J., and P. Minor. 1996. Detection of human parvovirus B19 DNA in plasma pools and blood products derived from these pools: implications for efficiency and consistency of removal of B19 DNA during manufacture. Br. J. Haematol. 93:714-719.[CrossRef][Medline]
- Schorling, S., G. Schalasta, G. Enders, and M. Zauke. 2004. Quantification of parvovirus B19 DNA using COBAS AmpliPrep automated sample preparation and LightCycler real-time PCR. J. Mol. Diagn. 6:37-41.[Abstract/Free Full Text]
- Stöcher, M., and J. Berg. 2004. Internal control DNA for PCR assays introduced into lambda phage particles exhibits nuclease resistance. Clin. Chem. 50:2163-2166.[Free Full Text]
- WalkerPeach, C. R., and B. L. Pasloske. 2004. DNA bacteriophage as controls for clinical viral testing. Clin. Chem. 50:1970-1971.[Free Full Text]
- WalkerPeach, C. R., M. Winkler, D. B. DuBois, and B. L. Pasloske. 1999. Ribonuclease-resistant RNA controls (armored RNA) for reverse transcription-PCR, branched DNA, and genotyping assays for hepatitis C virus. Clin. Chem. 45:2079-2085.[Abstract/Free Full Text]
- Weindel, K., M. Riedling, and A. Geiger. November 2000. Magnetic glass particles, method for their preparation and uses thereof. European patent specification EP 1 232 502.
- Wu, C. G., B. Mason, J. Jong, D. Erdman, L. McKernan, M. Oakley, M. Soucie, B. Evatt, and M. Y. Yu. 2005. Parvovirus B19 transmission by a high-purity factor VIII concentrate. Transfusion 45:1003-1010.[CrossRef][Medline]
- Young, N. S., and K. E. Brown. 2004. Parvovirus B19. N. Engl. J. Med. 350:586-597.[Free Full Text]
Journal of Clinical Microbiology, August 2007, p. 2570-2574, Vol. 45, No. 8
0095-1137/07/$08.00+0 doi:10.1128/JCM.00647-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.