This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vinasco, J.
Right arrow Articles by Moro, M. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vinasco, J.
Right arrow Articles by Moro, M. H.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, August 2007, p. 2716-2719, Vol. 45, No. 8
0095-1137/07/$08.00+0     doi:10.1128/JCM.01102-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Molecular Evidence of a New Strain of Ehrlichia canis from South America{triangledown}

Javier Vinasco,1 Olga Li,3 Arnaldo Alvarado,3 Diego Diaz,3 Luis Hoyos,3 Luis Tabachi,3 Kamesh Sirigireddy,1 Carolyn Ferguson,2 and Manuel H. Moro1*

Departments of Diagnostic Medicine/Pathobiology,1 Division of Biology, Kansas State University, Manhattan, Kansas 66506,2 Laboratory of Clinical Pathology, College of Veterinary Medicine, University of San Marcos, Lima, Peru3

Received 31 May 2007/ Accepted 3 June 2007


arrow
ABSTRACT
 
Blood samples from dogs with clinical signs compatible with ehrlichiosis were examined for infection of Ehrlichia canis using PCR, multiplex real-time PCR, and DNA sequencing analysis. Eleven of 25 samples were positive for a new strain of E. canis. This is the first molecular identification of E. canis infection in dogs from Peru.


arrow
TEXT
 
Ehrlichia canis is a rickettsial gram-negative bacterium responsible for canine monocytic ehrlichiosis (CME) in dogs (6, 7, 19) and is mainly transmitted by ticks of the Rhipicephalus group (9, 15). E. canis has a wide distribution in the world but most frequently occurs in tropical and subtropical regions (2, 8, 11, 12, 21). Recently there have been reports of E. canis in South America (1, 6, 16, 17), including the first report of a human case of E. canis infection in Venezuela (24). The severity of disease depends on the host's immune status, age, breed, and any current coinfection. Clinical manifestations may vary geographically, but in general the main clinical signs are anemia, thrombocytopenia, and leukopenia (14, 27). Microscopic and serological evaluations have been used in conjunction with clinical signs for diagnosis of CME. Recently, molecular tools, like PCR, have become more sensitive and specific methods to aid in the diagnosis of CME. The specific PCR amplifies a segment of the 16S rRNA gene, and sequences of this gene have been used to identify different strains of E. canis (26). Here we report the first genetic characterization of E. canis in dogs from Peru.

Twenty-five dogs with clinical signs compatible with Ehrlichia sp. infection that were brought by their owners to the Veterinary Teaching Hospital (Universidad de San Marcos, Lima, Peru) from July 2002 to June 2003 were selected for the study. The ages of the animals ranged from 6 months to 11 years, and 80% were males. More than 90% had a history of tick exposure as well as either thrombocytopenia or nonregenerative anemia, fever, anorexia, weight loss, ecchymoses, petechiation, and/or epistaxis.

Serum samples were evaluated for E. canis (SNAP 3 DX; IDDEX Laboratories, Westbrook, ME) according to the manufacturer's protocol. All 25 samples were positive by E. canis enzyme-linked immunosorbent assay.

DNA was extracted from EDTA-treated blood samples using a QiaAmp kit (QIAGEN, Inc., Valencia, CA) according to the manufacturer's protocol. Specific E. canis amplification was accomplished using a previously described technique (26) with some modifications. In this PCR, we used the forward primer CANIS (CAATTATTTATAGCCTCTGGCTATAGGA), reverse primer GA1UR (GAGTTTGCCGGGACTTCTTCT), and a HotStarTaq master mix kit (QIAGEN, Inc., Valencia, CA). Also, the multiplex real-time PCR (MRT-PCR) was used to detect E. canis, E. chaffeensis, E. ewingii, Anaplasma platys, and A. phagocytophilum (20), with DNA isolated as described above. All PCRs were performed using the Smart Cycler system (Cepheid, Sunnyvale, CA), as described previously. Eleven of the 25 blood samples tested positive for E. canis by specific PCR. The same 11 samples were also positive based on the MRT-PCR. None of the samples was positive for E. chaffeensis, E. ewiingii, A. platys, or A. phagocytophilum.

The 16S rRNA gene of E. canis was amplified as two fragments for sequencing. Therefore, two sets of oligonucleotide primers targeting a highly conserved 16S rRNA gene in E. canis were used for PCR to obtain the near-full-length 16S rRNA gene. The nucleotide sequences of the forward and reverse primer pairs used for amplification of 16S rRNA were as follows: 15F and 842R, ATCATGGCTCAGAACGAACG and CTCATCGTTTACTCGGTGGACT, respectively; and 537F and 1442R, CAGCAGCCGCGGTAATACG and GTGACGGGCAGTGTGTACAAG, respectively (26). The PCR products were purified from the gel (Millipore Corp., Bedford, MA) and cloned with the pGEM-T cloning kit (Promega, Madison, WI). Plasmids were isolated from the clones with the QIAprep Spin miniprep kit (QIAGEN, Inc., Valencia, CA). Plasmids with inserts were tested by specific E. canis PCR. Inserted sequences were sequenced using vector primers T7 and SPS6, and a CEQ 8000 genetic analysis system (Beckman Coulter, Fullerton, CA) was used for sequencing. Both the sense and antisense strands of each amplicon were sequenced, and sequences were aligned and edited manually. The 16S rRNA gene sequences were subjected to BLAST analysis of GenBank.

Sequences were aligned manually using Se-Al (18); the matrix was trimmed slightly on each end and was complete for the included sequences. Two sequences of Anaplasma were used as an outgroup. All phylogenetic analyses were conducted using PAUP* v4.0b10 (23), with gaps treated as missing data. Unweighted parsimony analysis was conducted by heuristic search with 100 random additions (with tree bisection-reconnection branch swapping and the Multrees option on), followed by full heuristic bootstrapping to evaluate support for branches (8a; with 1,000 replicates, each with 10 random additions and tree bisection-reconnection branch swapping). A neighbor-joining analysis was also conducted, with an uncorrected p (uncorrected number of changes between two sequences) distance measure. The aligned sequence data matrix including partial sequences of the 16S rRNA gene (PDE and other sequences from GenBank) was 1,300 bp long. All sequences from Peru were identical (100%) in all samples analyzed and named "PDE," for Peruvian dog Ehrlichia (GenBank accession no. DQ915970). The PDE sequence was nearly identical (99.9%) to the E. canis VHE, VDE, VTE, Ovina, and Kagoshima sequences (Table 1). Specific differences between PDE and almost all E. canis reported strains in this article were found at nucleotide positions 648, 941, and 1001 (Table 1).


View this table:
[in this window]
[in a new window]

 
TABLE 1. Comparison of nucleotide differences among 16S rRNA genes of E. canis from different sources

There were 134 variable characters, 100 of which were potentially parsimony informative. Parsimony analysis yielded two most parsimonious trees of 141 steps each, with a consistency index of 0.99. The new strain, PDE, grouped within a well-supported E. canis clade (Fig. 1). However, relationships within E. canis were not well resolved and did not enable any robust inferences regarding patterns of diversification. Indeed, all E. canis sequences and the included sequence of E. ovina were nearly identical (Table 1 and Fig. 1).


Figure 1
View larger version (20K):
[in this window]
[in a new window]

 
FIG. 1. Phylogenetic trees derived from the nucleotide sequences of 16S rRNA gene sequences from E. canis, E. chafeensis, A. platys, and A. phagocytophila. (a) Strict consensus of two most parsimonious trees resulting from analysis of 16S rRNA data, with bootstrap numbers (≥50) above branches. (b) Neighbor-joining tree. The sequence of interest in this study, PDE, represents E. canis (falling within a well-supported clade and cluster of E. canis samples). There are very poor resolution and weak support for any relationships within E. canis based on the 16S rRNA gene.

Canine ehrlichiosis is a potentially fatal disease, and diagnosis cannot be made based on clinical signs or serological results alone. Clinical signs may vary between different geographical regions, and serology does not differentiate between current infection and previous exposure to Ehrlichia, whereas PCR might indicate an active infection. Therefore, the assessment of clinical manifestations, serologic evaluation, and molecular evidence are all important for accurate diagnosis of ehrlichiosis.

The presence of dogs with E. canis in Peru raises concern that dogs may act as a reservoir of agents of human ehrlichiosis in this region, as purported for Venezuela (24). The possibility that dogs may facilitate transmission of these bacteria to humans increases their zoonotic importance.

The present work is the first to document infection of dogs with E. canis from Peru using molecular methods. It is clear that the new strain reported here, PDE, represents E. canis. While sequencing of the 16S gene enables positive identification of the bacterium, there is too little sequence variation within this evolutionarily conserved coding region to enable inference of the phylogenetic history of E. canis strains. An interesting future investigation would be the exploration of phylogeographic patterns of these strains: sequencing of a noncoding region of DNA for a diversity of E. canis samples might yield valuable information on the epidemiology of the disease.

Nucleotide sequence accession numbers. The GenBank accession numbers for the 16S rRNA nucleotide sequences of organisms used for comparison in this study are as follows: E. canis VDE, AF373613; E. canis VTE, AF373614 and AF373615; E. canis VHE, AF373612; E. canis Venezuela, AF287154; E. canis Oklahoma, M73221; E. canis Florida, M73226; E. canis 611(Israel), U26740; E. canis Gzh982, AF162860; E. canis Germishuys, U54805; E. canis Gxht67, AF156786; E. canis Gdt3, AF156785; E. canis 95E10, U96437; E. canis Okinawa, AF308455; E. canis Madrid, AY394465; E. canis Kagoshima, AF536827; Ehrlichia ovina Turkey, AF318946; E. canis Turkey, AY621071; E. canis Greece, EF011110 and EF011111; E. chaffeensis, M773222; E. ewingii, M73227; A. platys, AF156784; A. phagocyophila, DQ449948; Neorickettsia helminthoeca, U12457; and the new E. canis PDE reported here, DQ915970.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Diagnostic Medicine/Pathobiology, Kansas State University, Manhattan, Kansas 66506. Phone: (785) 532-4602. Fax: (785) 532-4851. E-mail: MMORO{at}vet.ksu.edu Back

{triangledown} Published ahead of print on 27 June 2007. Back


arrow
REFERENCES
 
    1
  1. Adrianzen, J., A. Chavez, E. Casas, and O. Li. 2003. Seroprevalencia de la dirofilariosis y ehrlichiosis canina en tres distritos de Lima. Rev. Inv. Peru 14:43-48.
  2. 2
  3. Aguirre, E., A. Sainz, S. Dunner, I. Amusategui, L. López, F. Rodriguez-Franco, I. Luaces, O. Cortés, and M. A. Tesouro. 2004. First isolation and molecular characterization of Ehrlichia canis in Spain. Vet. Parasitol. 125:365-372.[CrossRef][Medline]
  4. 3
  5. Allsopp, M., E. S. Visser, J. L. du Plessis, S. W. Vogel, and B. A. Allsopp. 1997. Different organisms associated with heartwater as shown by analysis of 16S ribosomal RNA gene sequences. Vet. Parasitol. 71:283-300.[CrossRef][Medline]
  6. 4
  7. Anderson, B. E., J. E. Dawson, D. C. Jones, and K. H. Wilson. 1991. Ehrlichia chaffeensis, a new species associated with human ehrlichiosis. J. Clin. Microbiol. 29:2838-2842.[Abstract/Free Full Text]
  8. 5
  9. Bekker, C. P., S. de Vos, A. Taoufik, O. A. Sparagano, and F. Jongejan. 2002. Simultaneous detection of Anaplasma and Ehrlichia species in ruminants and detection of Ehrlichia ruminantium in Amblyomma variegatum ticks by reverse line blot hybridization. Vet. Microbiol. 89:223-238.[CrossRef][Medline]
  10. 6
  11. Dagnone, A. S., H. S. de Morais, M. C. Vidotto, F. S. Jojima, and O. Vidotto. 2003. Ehrlichiosis in anemic, thrombocytopenic, or tick-infested dogs from a hospital population in South Brazil. Vet. Parasitol. 117:285-290.[CrossRef][Medline]
  12. 7
  13. de Castro, M. B., R. Z. Machado, L. P. de Aquino, A. C. Alessi, and M. T. Costa. 2004. Experimental acute canine monocytic ehrlichiosis: clinicopathological and immunopathological findings. Vet. Parasitol. 119:73-86.[CrossRef][Medline]
  14. 8
  15. Ewing, S. A. 1972. Geographic distribution and tick transmission of Ehrlichia canis. J. Med. Entomol. 9:597-598.
  16. 8
  17. Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39:783-791.[CrossRef]
  18. 9
  19. Groves, M. G., G. L. Dennis, H. L. Amyx, and D. L. Huxsoll. 1975. Transmission of Ehrlichia canis to dogs by ticks (Rhipicephalus sanguineus). Am. J. Vet. Res. 36:937-940.[Medline]
  20. 10
  21. Hua, P., M. Yuhai, T. Shide, S. Yang, W. Bohai, and C. Xiangrui. 2000. Canine ehrlichiosis caused simultaneously by Ehrlichia canis and Ehrlichia platys. Microbiol. Immunol. 44:737-739.[Medline]
  22. 11
  23. Inokuma, H., T. Beppu, M. Okuda, Y. Shimada, and Y. Sakata. 2003. Epidemiological survey of Anaplasma platys and Ehrlichia canis using ticks collected from dogs in Japan. Vet. Parasitol. 115:343-348.[CrossRef][Medline]
  24. 12
  25. Keefe, T. J., C. J. Holland, P. E. Salyer, and M. Ristic. 1982. Distribution of Ehrlichia canis among military working dogs in the world and selected civilian dogs in the United States. J. Am. Vet. Med. Assoc. 181:236-238.[Medline]
  26. 13
  27. Keysary, A., T. Waner, M. Rosner, C. K. Warner, J. E. Dawson, R. Zass, K. L. Biggie, and S. Harrus. 1996. The first isolation, in vitro propagation, and genetic characterization of Ehrlichia canis in Israel. Vet. Parasitol. 62:331-340.[CrossRef][Medline]
  28. 14
  29. Kuehn, N. F., and S. D. Gaunt. 1985. Clinical and hematologic findings in canine ehrlichiosis. J. Am. Vet. Med. Assoc. 186:355-358.[Medline]
  30. 15
  31. Lewis, G. E., Jr., M. Ristic, R. D. Smith, T. Lincoln, and E. H. Stephenson. 1977. The brown dog tick Rhipicephalus sanguineus and the dog as experimental hosts of Ehrlichia canis. Am. J. Vet. Res. 38:1953-1955.[Medline]
  32. 16
  33. López, J., M. Rivera, J. C. Concha, S. Gatica, M. Loeffeholz, and O. Barriga. 2003. Ehrlichiosis humana en Chile, evidencia serológica. Rev. Med. Chile 131:67-70.[Medline]
  34. 17
  35. Perez, M., Y. Rikihisa, and B. Wen. 1996. Ehrlichia canis-like agent isolated from a man in Venezuela: antigenic and genetic characterization. J. Clin. Microbiol. 34:2133-2139.[Abstract]
  36. 18
  37. Rambaut, A. 1996. Se-Al: Sequence Alignment Editor, v2.0a11. University of Oxford, Oxford, United Kingdom.
  38. 19
  39. Rikihisa, Y., S. A. Ewing, J. C. Fox, A. G. Siregar, F. H. Pasaribu, and M. B. Malole. 1992. Analyses of Ehrlichia canis and a canine granulocytic Ehrlichia infection. J. Clin. Microbiol. 30:143-148.[Abstract/Free Full Text]
  40. 20
  41. Sirigireddy, K. R., and R. R. Ganta. 2005. Multiplex detection of Ehrlichia and Anaplasma species pathogens in peripheral blood by real-time reverse transcriptase-polymerase chain reaction. J. Mol. Diagnostics 7:308-316.
  42. 21
  43. Stephenson, E. H., and M. Ristic. 1978. Retrospective study of an Ehrlichia canis epizootic around Phoenix, Arizona. J. Am. Vet. Med. Assoc. 172:63-65.[Medline]
  44. 22
  45. Suto, Y., A. Suto, H. Inokuma, H. Obayashi, and T. Hayashi. 2001. First confirmed canine case of Ehrlichia canis infection in Japan. Vet. Rec. 148:809-811.[Abstract/Free Full Text]
  46. 23
  47. Swofford, D. L. 2002. PAUP* v4.0b10: phylogenetic analysis using parsimony (* and other methods). Sinauer, Sunderland, MA.
  48. 24
  49. Unver, A., M. Perez, N. Orellana, H. Huang, and Y. Rikihisa. 2001. Molecular and antigenic comparison of Ehrlichia canis isolates from dogs, ticks, and a human in Venezuela. J. Clin. Microbiol. 39:2788-2793.[Abstract/Free Full Text]
  50. 25
  51. Unver, A., Y. Rikihisa, M. Kawahara, and S. Yanamoto. 2003. Analysis of 16S rRNA gene sequences of Ehrlichia canis, Anaplasma platys, and Wolbachia species from canine blood in Japan. Ann. N. Y. Acad. Sci. 990:692-698.[Medline]
  52. 26
  53. Warner, C. K., and J. E. Dawson. 1996. Genus- and species-level identification of Ehrlichia species by PCR and sequencing, p. 100-105. In D. H. Persing (ed.), PCR protocols for emerging infectious diseases. ASM Press, Washington, DC.
  54. 27
  55. Woody, B. J., and J. D. Hoskins. 1991. Ehrlichial diseases of dogs. Vet. Clin. N. Am. Small Anim. Pract. 21:75-98.[Medline]


Journal of Clinical Microbiology, August 2007, p. 2716-2719, Vol. 45, No. 8
0095-1137/07/$08.00+0     doi:10.1128/JCM.01102-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Moro, P. L., Shah, J., Li, O., Gilman, R. H., Harris, N., Moro, M. H. (2009). Serologic Evidence of Human Ehrlichiosis in Peru. Am J Trop Med Hyg 80: 242-244 [Abstract] [Full Text]  
  • Zhang, X., Luo, T., Keysary, A., Baneth, G., Miyashiro, S., Strenger, C., Waner, T., McBride, J. W. (2008). Genetic and Antigenic Diversities of Major Immunoreactive Proteins in Globally Distributed Ehrlichia canis Strains. CVI 15: 1080-1088 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vinasco, J.
Right arrow Articles by Moro, M. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vinasco, J.
Right arrow Articles by Moro, M. H.