This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lockhart, S. R.
Right arrow Articles by Diekema, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lockhart, S. R.
Right arrow Articles by Diekema, D. J.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, January 2008, p. 374-376, Vol. 46, No. 1
0095-1137/08/$08.00+0     doi:10.1128/JCM.01790-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Lodderomyces elongisporus Masquerading as Candida parapsilosis as a Cause of Bloodstream Infections{triangledown}

Shawn R. Lockhart,1* Shawn A. Messer,1 Michael A. Pfaller,1 and Daniel J. Diekema1,2

Departments of Pathology,1 Internal Medicine, Carver College of Medicine, University of Iowa Hospitals and Clinics, Iowa City, Iowa2

Received 7 September 2007/ Accepted 10 October 2007


arrow
ABSTRACT
 
Ten yeast bloodstream isolates identified as Candida parapsilosis by conventional methods grew as turquoise blue colonies on Chromagar media. Subsequent sequence analysis showed that these isolates were the species Lodderomyces elongisporus. To our knowledge, this is the first published report of L. elongisporus as a cause of human disease.


arrow
TEXT
 
Candida parapsilosis is the third leading cause of Candida bloodstream infections in North America, the second leading cause of Candida bloodstream infections in Europe, and the second leading cause of candidemia in children (14, 15). This important pathogen can be found in a wide variety of niches and can cause life-threatening nosocomial infections. Recent studies have shown that some clinical isolates identified as C. parapsilosis are in fact isolates of the closely related species Candida orthopsilosis and Candida metapsilosis (8, 11, 19). Although comprising only about 10% of the total number of C. parapsilosis isolates (S. Lockhart, S. A. Messer, M. A. Pfaller, and S. Diekema, unpublished data), these other species may inhabit important niches in certain populations.

Molecular and biochemical investigations of other Candida species have also identified new species that had previously been identified as more common species, such as Candida dubliniensis/Candida albicans (18), Candida nivariensis/Candida glabrata (1), and Coccidioides posadasii/Coccidioides immitis (4). In our characterization of C. parapsilosis isolates from a worldwide collection, approximately 2% of the isolates were further examined because of their unique color on chromogenic media and because BanI-digested SADH fragment amplification screening did not reveal them to be C. parapsilosis, C. orthopsilosis, or C. metapsilosis (19).

All yeast isolates submitted to the University of Iowa as part of the ARTEMIS antifungal surveillance program were identified using the Vitek yeast identification system (bioMerieux, Durham, NC) and plated on BBL Chromagar Candida medium (Becton Dickinson and Company, Sparks, MD). A number of isolates that were identified as C. parapsilosis by the Vitek system were noted to have a distinct turquoise color on Chromagar Candida medium rather than the pink/lavender color that is typical for C. parapsilosis (Fig. 1). These isolates were further evaluated using the API 20C identification kit (bioMerieux, Durham, NC) and again were biochemically identified as C. parapsilosis (Table 1).


Figure 1
View larger version (169K):
[in this window]
[in a new window]

 
FIG. 1. Isolates were grown on BBL Chromagar Candida medium (Becton Dickinson and Company, Sparks, MD). L. elongisporus strain ATCC 22688 and L. elongisporus strain ATCC 11503 were the same color as isolate 1, shown here (labeled L. elongisporus).


View this table:
[in this window]
[in a new window]

 
TABLE 1. Biochemical assimilation of our Lodderomyces isolates by use of the API20 C panel

Large-subunit rRNA gene sequencing has recently been shown to be an accurate method for species identification of clinical yeast isolates (12). We amplified a large portion of the 18S and 26S rRNA gene, including the D1/D2 region, of seven isolates of our unknown species using primers ITS1 (5'TCCGTAGGTGAACCTGCGG3') and 26SR (5'GTTCGATTAGTCTTTCGCCCCTAT3'). Upon alignment using the ClustalW alignment software (2), all seven isolates were found to have identical 26S rRNA gene sequences over 992 base pairs. BlastN searches using the GenBank nucleotide database (http://www.ncbi.nlm.nih.gov/BLAST/) revealed 100% matches to submitted and published gene sequences of the variable region of the large ribosomal subunit from L. elongisporus (Table 2) (9, 10, 17). Identical sequence matches were also made for an SADH-like gene between the sequence of strain NRRL YB-4239 (Lodderomyces elongisporus Sequencing Project, the Broad Institute of Harvard and MIT [http://www.broad.mit.edu]), our isolates 1 to 4, and L. elongisporus strain ATCC 22688. On cornmeal agar, the isolates formed abundant short pseudohyphae that were indistinguishable from those of C. parapsilosis. However, when the isolates were inoculated on Saccharomyces sporulation medium, single large round ascospores were produced by most of the cells after 12 to 14 days.


View this table:
[in this window]
[in a new window]

 
TABLE 2. Sequence similarity of the partial 26S rRNA genes between various related species and isolate 1

All 10 of the isolates were isolated from patients with bloodstream infections, and all but 1 were reported to be nosocomial. Table 3 gives the origin and dates of isolation of our L. elongisporus isolates. Eight of the 10 isolates originated from a single hospital in Mexico, while the other 2 were from Asia. The isolates were distributed equally between men and women, but there was a preponderance of isolates from patients above the age of 40 years (80%). Only one of the patients died, but it was not clear whether the death was due to the L. elongisporus infection or other underlying causes. Random amplified polymorphic DNA analysis revealed two very distinct patterns for the isolates from the hospital in Mexico (data not shown). When also considering the temporal spread of the isolates, we did not believe that these isolates were the cause of a single sustained outbreak within that hospital, but we could not rule out the possibility that L. elongisporus had a nosocomial foothold within that hospital.


View this table:
[in this window]
[in a new window]

 
TABLE 3. L. elongisporus isolates identified in this study

Antifungal susceptibility testing was performed on 9 of the 10 L. elongisporus isolates by broth microdilution with fluconazole (range, 0.12 to 128 µg/ml), caspofungin (range, 0.007 to 8 µg/ml), anidulafungin (range, 0.007 to 8 µg/ml), and micafungin (range, 0.007 to 8 µg/ml) and by Etest for amphotericin B (13a; Table 4). There are no established breakpoint values for L. elongisporus. However, the MICs of our isolates are well below the normally achieved plasma levels for these drugs.


View this table:
[in this window]
[in a new window]

 
TABLE 4. MICs of five antifungal agents for study isolatesa

To our knowledge, L. elongisporus has never been reported as a cause of human infection and yet we have isolated it as a cause of bloodstream infections in 10 patients. Its physiological similarity to C. parapsilosis may have allowed this species to remain undetected in clinical samples since its discovery and description (16, 20), and in fact two typing systems identified our isolates as C. parapsilosis. This is the third recent yeast species found to be closely related to, and clinically impersonating, C. parapsilosis.

Aside from phylogenetic studies, there is very little published information about L. elongisporus. The ATCC collection hints at a worldwide distribution for this yeast, with isolates from South Africa, Finland, The Netherlands, and the United States. However, our clinical samples came from Asia and a single center in Mexico despite a survey of 542 C. parapsilosis isolates from 25 countries on five continents. Our current collection of L. elongisporus isolates is limited to nosocomial bloodstream pathogens from older patients. We are currently prospectively analyzing a worldwide collection of C. parapsilosis isolates for the presence of L. elongisporus.

L. elongisporus was previously believed to be the teleomorph of C. parapsilosis (6), but recent small-subunit rRNA gene sequencing data have shown that it is a closely related but distinct species (7). In a large multigenic sequence analysis study of Candida and related species, L. elongisporus falls within the clade of pathogenic species containing C. parapsilosis, Candida tropicalis, C. albicans, and C. dubliniensis (3). It is the only species in that clade which forms ascospores.

Molecular identification of fungal isolates is becoming an important diagnostic tool (5, 12, 13). There have been a number of recent cases where two species are so similar phenotypically that only molecular techniques can distinguish them (1, 4, 11, 19). It is quite possible that there are a number of new yeast species in clinical material that cannot be distinguished phenotypically from a more common species. As molecular identification and genotyping become more common in clinical practice, we may find more examples of masquerading species. In the 1990s, C. parapsilosis was a single species of yeast; now it is a four-species complex.


arrow
ACKNOWLEDGMENTS
 
This study was supported in part by research grants from Pfizer and Merck.

We thank Linda Boyken, Shailesh Tendolkar, Jennifer Kroeger, and Richard Hollis for their contributions to this work.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: University of Iowa Hospitals and Clinics, Department of Pathology, 6008 BT GH, 200 Hawkins Drive, Iowa City, IA 52242-1009. Phone: (319) 356-2104. Fax: (319) 356-4916. E-mail: shawn-lockhart{at}uiowa.edu Back

{triangledown} Published ahead of print on 24 October 2007. Back


arrow
REFERENCES
 
    1
  1. Alcoba-Flórez, J., S. Méndez-Álvarez, J. Cano, J. Guarro, E. Pérez-Roth, and M. del Pilar Arévalo. 2005. Phenotypic and molecular characterization of Candida nivariensis sp. nov., a possible new opportunistic fungus. J. Clin. Microbiol. 43:4107-4111.[Abstract/Free Full Text]
  2. 2
  3. Chenna, R., H. Sugawara, T. Koike, R. Lopez, T. J. Gibson, D. G. Higgins, and J. D. Thompson. 2003. Multiple sequence alignment with the Clustal series of programs. Nucleic Acids Res. 31:3497-3500.[Abstract/Free Full Text]
  4. 3
  5. Diezmann, S., C. J. Cox, G. Schönian, R. J. Vilgalys, and T. G. Mitchell. 2004. Phylogeny and evolution of medical species of Candida and related taxa: a multigenic analysis. J. Clin. Microbiol. 42:5624-5635.[Abstract/Free Full Text]
  6. 4
  7. Fisher, M. C., G. L. Koenig, T. J. White, and J. W. Taylor. 2002. Molecular and phenotypic description of Coccidioides posadasii sp. nov., previously recognized as the non-California population of Coccidioides immitis. Mycologia 94:73-84.[Abstract/Free Full Text]
  8. 5
  9. Hall, L., S. Wohlfiel, and G. D. Roberts. 2003. Experience with the MicroSeq D2 large-subunit ribosomal DNA sequencing kit for identification of commonly encountered, clinically important yeast species. J. Clin. Microbiol. 41:5099-5102.[Abstract/Free Full Text]
  10. 6
  11. Hamajima, K., A. Nishikawa, T. Shinoda, and Y. Fukazawa. 1987. Deoxyribonucleic acid base composition and its homology between two forms of Candida parapsilosis and Lodderomyces elongisporus. J. Gen. Appl. Microbiol. 33:299-302.[CrossRef]
  12. 7
  13. James, S. A., M. D. Collins, and I. N. Roberts. 1994. The genetic relationship of Lodderomyces elongisporus to other ascomycete yeast species as revealed by small subunit rRNA gene sequences. Lett. Appl. Microbiol. 19:308-311.[Medline]
  14. 8
  15. Kocsubé, S., M. Tóth, C. Vógvölgyi, I. Dóczi, M. Pesti, I. Pócsi, J. Szabó, and J. Varga. 2007. Occurrence and genetic variability of Candida parapsilosis sensu lato in Hungary. J. Med. Microbiol. 56:190-195.[Abstract/Free Full Text]
  16. 9
  17. Kurtzman, C. P., and C. J. Robnett. 1997. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5' end of the large-subunit (26S) ribosomal DNA gene. J. Clin. Microbiol. 35:1216-1223.[Abstract]
  18. 10
  19. Kurtzman, C. P., and C. J. Robnett. 1998. Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences. Antonie van Leeuwenhoek 73:331-371.[CrossRef][Medline]
  20. 11
  21. Lin, D., L. C. Wu, M. G. Rinaldi, and P. F. Lehmann. 1995. Three distinct genotypes within Candida parapsilosis from clinical sources. J. Clin. Microbiol. 33:1815-1821.[Abstract]
  22. 12
  23. Linton, C. J., A. M. Borman, G. Cheung, A. D. Holmes, A. Szekely, M. D. Palmer, P. D. Bridge, C. K. Campbell, and E. M. Johnson. 2007. Molecular identification of unusual pathogenic yeast isolates by large ribosomal subunit gene sequencing: 2 years of experience at the United Kingdom Mycology Reference Laboratory. J. Clin. Microbiol. 45:1152-1158.[Abstract/Free Full Text]
  24. 13
  25. Leaw, S. N., H. C. Chang, H. F. Sun, R. Barton, J. P. Bouchara, and T. C. Chang. 2006. Identification of medically important yeast species by sequence analysis of the internal transcribed spacer regions. J. Clin. Microbiol. 44:693-699.[Abstract/Free Full Text]
  26. 13
  27. National Committee for Clinical Laboratory Standards. 2002. Reference method for broth microdilution antifungal susceptibility testing of yeast, 2nd edition. Approved standard M27-A2. National Committee for Clinical Laboratory Standards, Wayne, PA.
  28. 13
  29. Odds, Frank C., Mary Motyl, Roberto Andrade, Jacques Bille, Emilia Cantón, Manuel Cuenca-Estrella, Amanda Davidson, Christian Durussel, David Ellis, Elyse Foraker, Annette W. Fothergill, Mahmoud A. Ghannoum, Robert A. Giacobbe, Miguel Gobernado, Rosemary Handke, Michel Laverdière, Wendy Lee-Yang, William G. Merz, Luis Ostrosky-Zeichner, Javier Pemán, Sophia Perea, John R. Perfect, Michael A. Pfaller, Laurie Proia, John H. Rex, Michael G. Rinaldi, Juan-Luis Rodriguez-Tudela, Wiley A. Schell, Christine Shields, Deanna A. Sutton, Paul E. Verweij, and David W. Warnock. 2004. Interlaboratory comparision of results of susceptibility testing with caspofungin against Candida and Aspergillus species. J. Clin. Microbiol. 42:3475-3782.[Abstract/Free Full Text]
  30. 14
  31. Pfaller, M. A., L. Boyken, R. J. Hollis, S. A. Messer, S. Tendolkar, and D. J. Diekema. 2006. In vitro susceptibilities of Candida spp. to caspofungin: four years of global surveillance. J. Clin. Microbiol. 44:760-763.[Abstract/Free Full Text]
  32. 15
  33. Pfaller, M. A., and D. J. Diekema. 2007. Epidemiology of invasive candidiasis: a persistent public health problem. Clin. Microbiol. Rev. 20:133-163.[Abstract/Free Full Text]
  34. 16
  35. Recca, J., and E. M. Mrak. 1952. Yeasts occurring in citrus products. Food Technol. 6:450-454.[Medline]
  36. 17
  37. Rycovska, A., M. Valach, L. Tomaska, M. Bolotin-Fukuhara, and J. Nosek. 2004. Linear versus circular mitochondrial genomes: intraspecies variability of mitochondrial genome architecture in Candida parapsilosis. Microbiology 150:1571-1580.[Abstract/Free Full Text]
  38. 18
  39. Sullivan, D. J., T. J. Westerneng, K. A. Haynes, D. E. Bennett, D. C. Coleman. 1995. Candida dubliniensis sp. nov.: phenotypic and molecular characterization of a novel species associated with oral candidosis in HIV-infected individuals. Microbiology 141:1507-1521.[Abstract/Free Full Text]
  40. 19
  41. Tavanti, A., A. D. Davidson, N. A. R. Gow, M. C. J. Maiden, and F. C. Odds. 2005. Candida orthopsilosis and Candida metapsilosis spp. nov. to replace Candida parapsilosis groups II and III. J. Clin. Microbiol. 43:284-292.[Abstract/Free Full Text]
  42. 20
  43. van der Walt, J. P. 1966. Lodderomyces, a new genus of the Saccharomycetaceae. Antonie van Leeuwenhoek 32:1-5.[CrossRef][Medline]


Journal of Clinical Microbiology, January 2008, p. 374-376, Vol. 46, No. 1
0095-1137/08/$08.00+0     doi:10.1128/JCM.01790-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Diekema, D. J., Messer, S. A., Boyken, L. B., Hollis, R. J., Kroeger, J., Tendolkar, S., Pfaller, M. A. (2009). In Vitro Activity of Seven Systemically Active Antifungal Agents against a Large Global Collection of Rare Candida Species as Determined by CLSI Broth Microdilution Methods. J. Clin. Microbiol. 47: 3170-3177 [Abstract] [Full Text]  
  • Asadzadeh, M., Ahmad, S., Al-Sweih, N., Khan, Z. U. (2009). Rapid molecular differentiation and genotypic heterogeneity among Candida parapsilosis and Candida orthopsilosis strains isolated from clinical specimens in Kuwait. J Med Microbiol 58: 745-752 [Abstract] [Full Text]  
  • Tay, S. T., Na, S. L., Chong, J. (2009). Molecular differentiation and antifungal susceptibilities of Candida parapsilosis isolated from patients with bloodstream infections. J Med Microbiol 58: 185-191 [Abstract] [Full Text]  
  • Lockhart, S. R., Messer, S. A., Pfaller, M. A., Diekema, D. J. (2009). Identification and Susceptibility Profile of Candida fermentati from a Worldwide Collection of Candida guilliermondii Clinical Isolates. J. Clin. Microbiol. 47: 242-244 [Abstract] [Full Text]  
  • Lockhart, S. R., Messer, S. A., Pfaller, M. A., Diekema, D. J. (2008). Geographic Distribution and Antifungal Susceptibility of the Newly Described Species Candida orthopsilosis and Candida metapsilosis in Comparison to the Closely Related Species Candida parapsilosis. J. Clin. Microbiol. 46: 2659-2664 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lockhart, S. R.
Right arrow Articles by Diekema, D. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lockhart, S. R.
Right arrow Articles by Diekema, D. J.