Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Supplemental material Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Woods, D. F. Articles by Boyd, E. F. Search for Related Content PubMed PubMed Citation Articles by Woods, D. F. Articles by Boyd, E. F.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, December 2008, p. 4018-4022, Vol. 46, No. 12
0095-1137/08/$08.00+0     doi:10.1128/JCM.01229-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Rapid Multiplex PCR and Real-Time TaqMan PCR Assays for Detection of Salmonella enterica and the Highly Virulent Serovars Choleraesuis and Paratyphi C ^,

David F. Woods,¹ F. Jerry Reen,¹ Deirdre Gilroy,² Jim Buckley,³ Jonathan G. Frye,⁴ and E. Fidelma Boyd^5*

Department of Microbiology, UCC, National University of Ireland, Cork, Ireland,¹ Department of Biology, Cork Institute of Technology, Cork, Ireland,² Veterinary Laboratory, Cork County Council, Cork, Ireland,³ Bacterial Epidemiology and Antimicrobial Resistance Research Unit, Agricultural Research Service, U.S. Department of Agriculture, Athens, Georgia,⁴ Department of Biological Sciences, University of Delaware, Newark, Delaware 19716⁵

Received 29 June 2008/ Returned for modification 11 September 2008/ Accepted 3 October 2008

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 
Salmonella enterica is a human pathogen with over 2,500 serovars characterized. S. enterica serovars Choleraesuis and Paratyphi C are two globally distributed serovars. We have developed a rapid molecular-typing method to detect serovars Choleraesuis and Paratyphi C in food samples by using a comparative-genomics approach to identify regions unique to each serovar from the sequenced genomes. A Salmonella-specific primer pair based on oriC was designed as an internal control to establish accuracy, sensitivity, and reproducibility. Serovar-specific primer sets based on regions of difference between serovars Choleraesuis and Paratyphi C were designed for real-time PCR assays. Three primer sets were used to screen a collection of over 100 Salmonella strains, and both serovars Choleraesuis and Paratyphi C gave unique amplification patterns. To develop the technique for practical use, its sensitivity for detection of Salmonella spp. in a food matrix was determined by spiking experiments. The technique was also adapted for a real-time PCR rapid-detection assay for both serovars Choleraesuis and Paratyphi C that complements the current procedures for Salmonella sp. isolation and serotyping.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 
Salmonella enterica is the causative agent of a wide range of acute serovar-specific infections, which include gastroenteritis (S. enterica serovar Typhimurium) and bacteremia (S. enterica serovar Choleraesuis and S. enterica serovar Typhi) (11, 20, 29, 30). S. enterica is transmitted to humans via the food chain, leading to morbidity and mortality, and can also cause severe economic losses due to food recalls (4, 26, 29, 30, 32, 33). It is estimated that S. enterica infections cause 1.4 million cases and cost between $500 million and $2.3 billion in losses in the United States per year, and this is only a fraction of the incidence rate in developing countries (18, 21, 33).

The genus Salmonella currently contains two species, Salmonella enterica and Salmonella bongori (formerly subspecies V) (13-16, 19, 22, 25). S. enterica is subdivided into seven subspecies: I, II, IIIa, IIIb, IV, VI, and VII (3, 22). Salmonella infections in warm-blooded animals are generally caused by strains from S. enterica subspecies I. Currently, there are more than 1,400 serovars within S. enterica subspecies I (22). Certain serovars cause variable disease symptoms in different hosts, ranging from gastroenteritis to highly invasive diseases. For example, S. enterica serovar Choleraesuis causes sepsis or extraintestinal focal infection in humans and paratyphoid in swine (6). S. enterica serovars Choleraesuis and Paratyphi C have higher mortality rates in humans than other Salmonella serovars (5, 6, 11). S. enterica serovar Paratyphi C is highly adapted to humans, in whom it can cause a typhoid-like disease and recurrent intra-abdominal abscesses (9, 28). Interestingly, there has been a sharp increase in the number of multidrug-resistant outbreaks associated with both serovars Choleraesuis and Paratyphi in recent years (9, 28).

Serotyping is the method of choice to identify and discriminate isolates of S. enterica. However, the method has a number of deficiencies, including the inability to serotype between 5 and 8% of isolates and incorrect typing due to the loss of surface antigens (12, 27). There has been a general move toward molecular methods of Salmonella detection and typing, which are based less on phenotypic features and more on stable genotypic characteristics (1, 12). Molecular methods, such as PCR, are used for the identification of many food pathogens. Real-time (RT) PCR shows promise as an effective and accurate technology and has a high degree of agreement with conventional culture methods for Salmonella (10, 31). Whole-genome Salmonella-sequencing projects have shown that there is extensive sequence conservation and synteny among genomes (1, 12, 17, 23). It is estimated, however, that an average of 10 to 20% unique DNA has been acquired among the different serovars since the species diverged (1, 12, 17, 23, 24). Comparative microarray analysis of the closely related serovars Enteriditis, Gallinarum, and Dublin identified specific regions unique to each serovar (23, 24).

The detection and accurate identification of S. enterica pathogens in the food chain at various stages (from field to fork) is essential for the prevention of a wide variety of life-threatening infections. In this study, we performed in silico S. enterica whole-genome sequence comparisons to identify regions unique to two highly virulent S. enterica serovars, Choleraesuis and Paratyphi C. In addition, we designed a primer pair based on the oriC region that specifically amplifies Salmonella isolates only. A multiplex PCR protocol was developed using three primer sets for the detection of serovars Choleraesuis and Paratyphi C. This was further developed into a rapid RT-PCR TaqMan assay to detect these serovars in a food matrix.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 
Bacterial strains. Salmonella Reference Collection B (SARB), encompassing 37 serovars of subspecies I, and Salmonella Reference Collection C (SARC), encompassing 80 isolates of S. enterica and S. bongori, were used for primer pair validation (see Table S1 in the supplemental material) (2, 3). A total of 38 S. enterica strains recovered in Ireland representing nine serovars were also included in the study (see Table S1 in the supplemental material). The total collection of isolates examined included 190 Salmonella strains. Overnight cultures were prepared in Luria-Bertani (LB) medium supplemented with 2% NaCl at 37°C with agitation. The strains were stored at –70°C in LB broth containing 20% glycerol. Strains were chosen that encompassed seven different subspecies, as well as the species S. bongori, to validate our Salmonella indicator primer set for the oriC sequence. For the validation of serovar detection, 110 strains representing 56 serovars were chosen to be screened, including strains that are highly similar genetically (2, 3). Strains of Escherichia coli, Pseudomonas fluorescens, and Listeria monocytogenes were included in the screening process as negative controls.

Bioinformatics analysis. The full nucleotide sequences and annotations of S. enterica serovar Typhimurium LT2 (NC_003197), S. enterica serovar Typhi CT18 (NC_003198), S. enterica serovar Typhi Ty2 (NC_004631), S. enterica serovar Choleraesuis SC-B67 (NC_006905), and S. enterica serovar Paratyphi A ATCC 9150 (NC_006511) were downloaded from the National Center for Biotechnology Information database (http://www.ncbi.nlm.nih.gov/). The Web-based Artemis Comparison Tool (WebACT) (http://www.webact.org/WebACT/home) was used to identify regions unique to each serovar. The Basic Local Alignment Search Tool (http://ncbi.nih.gov/BLAST/) was used to check for sequence homology in the database.

Genomic-DNA isolation. Genomic DNA was isolated using a Gnome DNA isolation kit (Bio 101 Inc., La Jolla, CA) according to the manufacturer's instructions. The extracted genomic DNA was resuspended in 300 µl of Tris-EDTA. Primer3 (v.0.4.0) was used to design DNA primer pairs and DNA probes. The primer and probe outputs were manually adjusted for incorporation into a triplex PCR assay. The primer pairs for multiplex PCR (mPCR) were ConOri-F (GCGGTGGATTCTACTCAAC) and ConOri-R (AGAAGCGGAACTGAAAGGC), which amplify a 461-bp product; CsPcSC4352-F (TCGAGGGTTAAAGATGGGG) and CsPcSC4352-R (TACCACACGCTAAGCAACC), which amplify a 709-bp product; and STM3664-F (ATGAAACTTGCCGCCTTCGCTC) and STM3664-R (AATAGAGCGCGCCGAACTGA), which amplify a 997-bp product.

Serovar detection assay. Spiked samples were prepared as follows. Single colonies were inoculated into 5 ml of LB broth and incubated at 37°C for 6 h. Serial dilution and plating were used to determine bacterial CFU. For the comminuted food matrix, 10 g of ground meat (or 10 ml of pasteurized milk matrix) was inoculated with 1 ml of spiked LB broth. Preenrichment was carried out by stomaching 10 g of the spiked matrix with 90 ml of buffered peptone water (Oxoid) supplemented with 1.6 ml of 0.1% Novobiocin (Sigma) for 30 s and incubating it at 37°C for 18 h (7). After the incubation, 0.1 ml of the culture was inoculated into 10 ml of Rappaport-Vassiliadis (RV) medium (Oxoid) and incubated at 42°C for 24 h. In tandem with this, 1 ml was inoculated into 10 ml of Muller-Kauffmann tetrathionate Novobiocin broth (MKTTn) (Cruinn Diagnostics Ltd., Dublin, Ireland) and incubated at 37°C for 24 h. The presence of presumptive positive Salmonella spp. was confirmed on xylose lysine deoxycholate agar (Cruinn) and on Harlequin Salmonella ABC agar.

mPCR assay. The mPCR assay was conducted on 1 µl of the enrichment media from spiked samples or 0.75 µl of DNA. The PCR cocktails each included 10 µl of 5x buffer, 1.5 mM MgCl₂, 125 µM nucleotide mixture, 15 pmol of each primer, 1 U of Taq polymerase, and sterile distilled water to 50 µl. A Peltier thermal cycler 200 was used for all PCRs. The PCR conditions used were 96°C for 5 min (or 2 min for initial DNA development), followed by 29 cycles of 94°C for 30 s, 53°C for 30 s, and 72°C for 1 min, followed by 72°C for 10 min.

RT-PCR assay. RT-PCR was conducted using the QuantiTect Multiplex PCR kit (Qiagen, Valencia, CA) according to the manufacturer's instructions, with the following adaptations. The cycling conditions were amended to 95°C for 15 min, followed by 30 cycles of 94°C for 15 s and 60°C for 60 s. The reaction mixture contained 0.2 µM of RTSTM3664-F (GAATCATGCCGGTTACGC) and RTSTM3664-R (GCCAGTTTGTCCAGCGAT); 0.4 µM of RTSC4352-F (ATAAAGATCTACAGGTCCTA), RTSC4352-R (TTAAAGTCTCGCCAAGTAGA), RTConOri-F (CGGATCCTGTAATAAAGATC), and RTConOri-R (CCCAGCTTATACGGACCA); 0.2 µM of RTSTM3664-Pr (Cy5-AGTATCAGTTCGGCGCGCTCTATTTATC-BHQ-3); 0.3 µM of RTSC4352-Pr (6-carboxyfluorescein-CTTATGCTTCTCAAGATGTTTTGCTTGA-BHQ-1) and RTConOri-Pr (Rox-ACCGATCATTCACAGCTAGTGATCCTTT-BHQ-2); 25 µl of 2x Quantitect mPCR mixture; and 5 µl of template made up to 50 µl with sterile distilled water. The TaqMan RT-PCR was conducted on a Rotor-Gene 6000 (Corbett Life Science, Sydney, New South Wales, Australia). The copy numbers of the target identification sequences were calculated using the following formula: m = (n) (1.096e–21 g/bp) where n is the number of base pairs and m is the mass of the DNA.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 
Design of an IAC. The Salmonella origin of replication (oriC) was chosen as a genus-specific region for an internal amplified control (IAC) to establish the specificity and sensitivity of the mPCR. The IAC primer pair was validated using 72 subspecies I strains and 80 strains encompassing subspecies II, IIIa, IIIb, IV, and VI and S. bongori (see Table S1 in the supplemental material) (2, 3). The oriC primer pair (ConOri-F and ConOri-R) amplified an expected 461-bp PCR product in all Salmonella strains tested, and no product was obtained with the negative controls (Fig. 1).

View larger version (25K): [in this window] [in a new window]

FIG. 1. The 461-bp PCR amplicon using the primer set ConOri-F and ConOri-R showing a representative group from the SARB and SARC of the strains in Table S1 in the supplemental material. Lane 1, 1-kb ladder.

Identification of serovar-specific genomic regions. Comparative genomic analysis identified regions unique to S. enterica serovars Choleraesuis and Paratyphi C. The genomic analysis tool WebACT was used to compare the genome of serovar Choleraesuis to the published sequenced genomes of S. enterica serovars Typhimurium LT2, Paratyphi A ATCC 9150, Typhi CT18, and Typhi Ty2. This analysis identified a 12.8-kb region unique to serovar Choleraesuis between open reading frames SC4343 and SC4353, which was previously identified as a metabolic island (6). In addition, an 11-kb region encompassing open reading frames STM3664 to STM3674 was identified that was present only in serovars Paratyphi C and Typhimurium. A PCR primer set (CsPcSC4352-F and CsPcSC4352-R) was designed for the 12.8-kb region and was used to screen our strain collection. An expected 709-bp PCR product was present in all serovar Choleraesuis isolates tested; however, a product was also present in serovar Paratyphi C isolates. Next, we designed primer pair STM3664-F and STM3664-R specific to the 11-kb region and used it to screen the strain collection. An expected 986-bp product was obtained from all serovar Paratyphi C isolates, as well as from all serovar Typhimurium, Enteriditis, and Typhi isolates, but was absent from all serovar Choleraesuis isolates examined. Both primer pairs were chosen as potential serovar-specific probes using an mPCR approach.

Development and optimization of the mPCR screen. To develop the mPCR assay, primers ConOri-F and ConOri-R, CsPcSC4352-F and CsPcSC4352-R, and STM3664-F and STM3664-R were combined and conditions were optimized as described in Materials and Methods to achieve specific and sensitive amplification of the three target regions. The mPCR assay was validated against the strain collection to detect all Salmonella isolates and serovars Choleraesuis and Paratyphi C when present (Fig. 2A). The positive identification of all Salmonella isolates resulted in the amplification of a 461-bp PCR product (Fig. 2A). From serovar Choleraesuis isolates, two PCR products were amplified, a 461-bp Salmonella-specific product and a 709-bp serovar Choleraesuis-specific product. From serovar Paratyphi C isolates, three PCR products were amplified: 461 bp, 709 bp, and 986 bp (Fig. 2A). All isolates of serovars Enteriditis, Typhimurium, and Typhi tested gave two products in all assays, the Salmonella-specific oriC 461-bp PCR product and the 986-bp PCR product (see Table S1 in the supplemental material). All serovar Choleraesuis isolates, all serovar Paratyphi C isolates, and all other Salmonella serovar isolates gave the predicted amplicon patterns, resulting in 100% accuracy for 152 strains tested (see Table S1 in the supplemental material).

View larger version (58K): [in this window] [in a new window]

FIG. 2. (A) mPCR assay showing the positive identification of Salmonella spp. and serovars Choleraesuis and Paratyphi C by their specific banding patterns from DNA samples. A representative selection of other prevalent Salmonella serovars is shown. Lanes: M, 1-kb ladder; En, serovar Enteritidis; Pc, serovar Paratyphi C (SARB48 and SARB49); Tm, serovar Typhimurium; Cs, serovar Choleraesuis (SARB4, SARB6, and SC-B67); Tp, serovar Typhi (SARB63); N, negative control (null). (B) mPCR assay directly from the selective media RV and MKTTn. Lanes: M, 1-kb ladder; Pc, Cs, and Tm, serovars Paratyphi C, Choleraesuis, and Typhimurium (representative of all of the other serovars); Ec, E. coli; Pf, P. fluorescens; Lm, L. monocytogenes; N, no-template PCR control; Ns, no-initial-spike control.

Adaptation of the mPCR for analysis of food samples. For practical use, the mPCR was adapted to methodologies for the identification of the pathogens in food matrices. To ensure compliance with international regulations, the current international standard of operation, ISO 6579:2002, was taken into consideration. We included two individual enrichment steps to improve sensitivity. Food matrices spiked with Salmonella were preenriched in buffered peptone water medium, followed by enrichment in RV and MKTTn media, and the mPCR assay was conducted directly on the enrichment media. The expected 461-bp Salmonella-specific PCR band; the 461-bp and 709-bp bands for serovar Choleraesuis; and the 461-bp, 709-bp, and 986-bp PCR bands specific for serovar Paratyphi C were produced (Fig. 2B). However, MKTTn medium resulted in fainter bands and, in the serovar Typhimurium sample, the absence of an amplicon, whereas the mPCR results from the RV medium gave banding patterns identical to those from the assay conducted on DNA (Fig. 2). The MKTTn medium itself may inhibit the reaction or may contain a higher level of food matrix inhibitory factors, since 1 ml of spiked matrix was added to MKTTn medium as opposed to 0.1 ml in RV medium. Our method showed the identification of Salmonella directly from media with no requirement for prior DNA isolation. The specificity was also investigated using food matrices spiked with several other prevalent food-borne pathogens: serovar Typhimurium, E. coli, P. fluorescens, and L. monocytogenes (Fig. 2B). In each case, the assay identified only Salmonella spp. and serovar Choleraesuis and Paratyphi C isolates, and no amplicon was detected from non-Salmonella isolates.

To calculate sensitivity, food matrices were spiked with different levels of each of the serovars of interest, serovars Choleraesuis and Paratyphi C, from RV medium. An overnight culture of serovar Choleraesuis was diluted to 250 CFU, 25 CFU, 3 CFU, and extinction (the point at which there were no longer culturable colonies present in the dilution). Each of the dilutions was used to spike the matrix. Enrichment and mPCR assays were conducted directly on the RV medium. Serovar Choleraesuis was identified by two specific 461-bp and 709-bp bands at 250 CFU and 25 CFU (Fig. 3A, lanes 1 and 2, respectively). However, the assay could not detect bacteria at the level of 3 CFU (Fig. 3A, lane 3). There was also no amplification in the dilution to extinction or in the negative control. An overnight culture of serovar Paratyphi C was diluted to 200 CFU, 20 CFU, 2 CFU, and extinction. Serovar Paratyphi C was identified by the amplification of three specific PCR bands of 461 bp, 709 bp, and 986 bp at 200 CFU, 20 CFU, and 2 CFU (Fig. 3B, lanes 1 to 3, respectively). Faint bands of the appropriate size for serovar Paratyphi C identification were present at extinction, and the unspiked food matrix sample had a single band indicating a member of the genus Salmonella present in the food matrix prior to the spiking. This was not too surprising, as up to 10% of food matrices can be contaminated with Salmonella (8). PCR contamination was ruled out, as no amplicon was present in the control lane containing no template (lane 6). Our results show that the mPCR assay detects each serovar at very low levels (Fig. 3A and B).

View larger version (23K): [in this window] [in a new window]

FIG. 3. (A) Sensitivity of the mPCR serovar Choleraesuis identification assay. Lane 1 had an initial spike of 250 CFU, lane 2 had 25 CFU, and lane 3 had 3 CFU. Serovar Choleraesuis-specific bands at 461 bp and 709 bp appeared in lanes 1 and 2. (B) Sensitivity of the mPCR serovar Paratyphi C identification assay. Lane 1 had an initial spike of 200 CFU, lane 2 had 20 CFU, and lane 3 had 2 CFU. Serovar Paratyphi C-specific bands appeared in lane 1, lane 2, and lane 3. There were three faint serovar Paratyphi C bands in lane 4 and a single faint band of 461 bp in lane 5. (C) Salmonella serovar Paratyphi C and serovar Choleraesuis identification assays were tested on the alternative food matrix, pasteurized milk. Lane M, marker; lane Pc, serovar Paratyphi C; lane Cs, serovar Choleraesuis; lane Tm, serovar Typhimurium; lane N, no-template PCR control.

Reproducibility in different food matrices. To ensure the robustness and reproducibly of the assay, and also to assess interference by the matrix itself or its normal bacterial flora, an alternative food matrix, milk, was tested. This was done by spiking pasteurized milk in the same manner as described for comminuted meat. Salmonella and both serovars Paratyphi C and Choleraesuis could be clearly identified from the milk matrix by their specific banding patterns described above (Fig. 3C). The natural bacteria in the matrix, as well as the matrix itself, did not interfere with the identification of Salmonella or the serovars, and no inhibition was seen.

TaqMan RT-mPCR validation from DNA sources. A TaqMan RT-mPCR assay was subsequently developed for the identification of Salmonella spp. and the serovars Choleraesuis and Paratyphi C. This adaptation made the assay more automated and rapid. Three different fluorescent dyes were used, and probes and fluorophore information are detailed in Table 1. Standard curves were initially created for the calculation of the thresholds. Each copy number dilution was tested in duplicate for accuracy and reproducibility and was found to be almost linear, with the R² values being close to 1.0 (range, 0.97, 0.99, 0.99). The amplification efficiencies for the green and red channels were in the range of 90 to 100% (98% for both); this would show a near doubling of the amplicon in each cycle. The reaction efficiency value for the orange channel was 89%, which is lower than the cutoff point. However, as the assay is used for identification purposes, not quantification purposes, this is an accepted value. The slope on which the reaction efficiency was calculated was between –3.1 and –3.6 (with –3.322 corresponding to 100% PCR efficiency); all of the assay values lay within this range. With the test samples of DNA, all of the Salmonella spp. were identified by probes designed for the oriC sequence (orange channel). The green channel measured the fluorescence of the probe designed for a region within SC4343 to SC4353, which identifies serovars Choleraesuis and Paratyphi C among all the other serovars. The red channel measured the fluorescence of the probe designed for a region within STM3664 to STM3674, which differentiates serovars Choleraesuis and Paratyphi C from each other. Fig. S1A in the supplemental material shows that each of the Salmonella isolates tested was identified as positive, that both of the serovars of interest were also identified, and that no nonspecific fluorescence was detected.

View this table: [in this window] [in a new window]

TABLE 1. Probe and primer information, including fluorophore details, for the TaqMan RT-PCR assay conducted on a RotorGene 6000

Adapting the TaqMan RT-mPCR for practical use. For practical use, the DNA RT-mPCR-based methodology was tested for detection of bacteria in food matrices, taking into consideration international standards of operation. Figure S1B and C in the supplemental material shows the assay conducted directly on the enrichment media. Salmonella spp. and serovars Choleraesuis and Paratyphi C were clearly identified. The comminuted food matrix of turkey meat was spiked with a number of other bacteria, S. enterica serovar Typhimurium (7 x 10⁹ CFU/ml), E. coli (8 x 10⁹ CFU/ml), P. fluorescens (1 x 10⁹ CFU/ml), and L. monocytogenes (2 x 10⁹ CFU/ml) (see Fig. S1B and C in the supplemental material). The fluorescence with the samples spiked with P. fluorescens and L. monocytogenes was equivalent to that of the negative controls. The E. coli sample gave a degree of fluorescence identified by the orange channel; however, the adjustment of the threshold made it clear which of the samples were Salmonella positive and which were negative. S. enterica serovar Typhimurium was identified as a member of the genus Salmonella. To ensure that there was no contamination, two negative controls were tested: a reaction tube with no template and another that was from media with no initial spike. Both of these samples gave no fluorescence in any channel. Importantly, the natural bacterial flora and the proteins in the matrix itself did not interfere with the RT-PCR assay. Although the assay functioned as expected when conducted on the bacteria in RV samples, the crossing point (cycle threshold) was slightly higher than when the assay was conducted on pure DNA.

This highly reproducible, specific, and sensitive assay has the ability to detect two closely related yet pathogenically distinct serovars. These results demonstrate that Salmonella spp. can be identified with great speed, accuracy, and reproducibility. Currently, Salmonella spp. require up to 5 to 7 days for identification and Salmonella serovar identification can take up to 3 weeks; our assay identifies Salmonella spp. and the serovars of interest in less than 2 days (46 h). This study will complement the current lengthy procedures for Salmonella confirmation and serotyping and emphasizes the advantages of utilizing bioinformatics for beneficial practical applications.

 
We thank those who kindly provided us with some of the strains used in this study.

This study was supported by a FIRM, Department of Agriculture and Fishery Grant, Ireland, to E.F.B. and a Cork Council Student Grant to D.F.W.

The mention of trade names or commercial products is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the U.S. Department of Agriculture.

 
* Corresponding author. Mailing address: Department of Biological Sciences, University of Delaware, Newark, DE 19716. Phone: (302) 831-1088. Fax: (302) 831-2281. E-mail: fboyd{at}udel.edu

Published ahead of print on 15 October 2008.

Supplemental material for this article may be found at http://jcm.asm.org/.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 

1
1. Arrach, N., S. Porwollik, P. Cheng, A. Cho, F. Long, S. H. Choi, and M. McClelland. 2008. Salmonella serovar identification using PCR-based detection of gene presence and absence. J. Clin. Microbiol.
2
2. Boyd, E. F., F. S. Wang, P. Beltran, S. A. Plock, K. Nelson, and R. K. Selander. 1993. Salmonella reference collection B (SARB): strains of 37 serovars of subspecies I. J. Gen. Microbiol. 139:1125-1132.[Abstract/Free Full Text]
3
3. Boyd, E. F., F. S. Wang, T. S. Whittam, and R. K. Selander. 1996. Molecular genetic relationships of the salmonellae. Appl. Environ. Microbiol. 62:804-808.[Abstract]
4
4. Centers For Disease Control and Prevention. 2008. Multistate outbreak of human Salmonella infections caused by contaminated dry dog food-United States, 2006-2007. MMWR Morb. Mortal. Wkly. Rep. 57:521-524.[Medline]
5
5. Chen, P. L., C. J. Wu, C. M. Chang, H. C. Lee, N. Y. Lee, H. I. Shih, C. C. Lee, N. Y. Ko, L. R. Wang, and W. C. Ko. 2007. Extraintestinal focal infections in adults with Salmonella enterica serotype Choleraesuis bacteremia. J. Microbiol. Immunol. Infect. 40:240-247.[Medline]
6
6. Chiu, C., P. Tang, C. Chu, S. Hu, Q. Bao, J. Yu, Y. Y. Chou, H. S. Wang, and Y. S. Lee. 2005. The genome sequence of Salmonella enterica serovar Choleraesuis, a highly invasive and resistant zoonotic pathogen. Nucleic Acids Res. 33:1690-1698.[Abstract/Free Full Text]
7
7. Ellingson, J., J. Anderson, S. Carlson, and V. Sharma. 2004. Twelve hour real-time PCR technique for the sensitive and specific detection of Salmonella in raw and ready-to-eat meat products. Mol. Cell Probes 18:51-57.[CrossRef][Medline]
8
8. Heinitz, M., R. D. Ruble, D. E. Wagner, and S. Tatini. 2000. Incidence of Salmonella in fish and seafood. J. Food Prot. 63:579-592.[Medline]
9
9. Holt, K. E., N. R. Thomson, J. Wain, M. D. Phan, S. Nair, R. Hasan, Z. A. Bhutta, M. A. Quail, H. Norbertczak, D. Walker, G. Dougan, and J. Parkhill. 2007. Multidrug-resistant Salmonella enterica serovar Paratyphi A harbors IncHI1 plasmids similar to those found in serovar Typhi. J. Bacteriol. 189:4257-4264.[Abstract/Free Full Text]
10
10. Huang, B., S. Eglezos, B. A. Heron, H. Smith, T. Graham, J. Bates, and J. Savill. 2007. Comparison of multiplex PCR with conventional biochemical methods for the identification of Listeria spp. isolates from food and clinical samples in Queensland, Australia. J. Food Prot. 70:1874-1880.[Medline]
11
11. Jean, S. S., J. Y. Wang, and P. R. Hsueh. 2006. Bacteremia caused by Salmonella enterica serotype Choleraesuis in Taiwan. J. Microbiol. Immunol. Infect. 39:358-365.[Medline]
12
12. Kim, S., J. G. Frye, J. Hu, P. J. Fedorka-Cray, R. Gautom, and D. S. Boyle. 2006. Multiplex PCR-based method for identification of common clinical serotypes of Salmonella enterica subsp. enterica. J. Clin. Microbiol. 44:3608-3615.[Abstract/Free Full Text]
13
13. Le Minor, L., M. Y. Popoff, and J. Bockemuhl. 1990. Supplement 1989 (n. 33) to the Kauffmann-White scheme. Res. Microbiol. 141:1173-1177.[Medline]
14
14. Le Minor, L., M. Y. Popoff, B. Laurent, and D. Hermant. 1986. Characterization of a 7th subspecies of Salmonella: S. choleraesuis subsp. indica subsp. nov. Ann. Inst. Pasteur. Microbiol. 137B:211-217.[CrossRef]
15
15. Le Minor, L., M. Veron, and M. Popoff. 1982. A proposal for Salmonella nomenclature. Ann. Microbiol. (Paris) 133:245-254.[Medline]
16
16. Le Minor, L., M. Veron, and M. Popoff. 1982. The taxonomy of Salmonella. Ann. Microbiol. (Paris) 133:223-243.[Medline]
17
17. McClelland, M., K. E. Sanderson, J. Spieth, S. W. Clifton, P. Latreille, L. Courtney, S. Porwollik, J. Ali, M. Dante, F. Du, S. Hou, D. Layman, S. Leonard, C. Nguyen, K. Scott, A. Holmes, N. Grewal, E. Mulvaney, E. Ryan, H. Sun, L. Florea, W. Miller, T. Stoneking, M. Nhan, R. Waterston, and R. K. Wilson. 2001. Complete genome sequence of Salmonella enterica serovar Tm LT2. Nature 413:852-856.[CrossRef][Medline]
18
18. Miller, M. A., J. Sentz, M. A. Rabaa, and E. D. Mintz. 2008. Global epidemiology of infections due to Shigella, Salmonella serotype Typhi, and enterotoxigenic Escherichia coli. Epidemiol. Infect. 136:433-435.[Medline]
19
19. Nastasi, A., C. Mammina, M. R. Villafrate, M. F. Massenti, G. Scarlata, and M. Diquattro. 1988. Multiple typing of strains of Salmonella enterica subsp. bongori ser. 48:Z35:- isolated in southern Italy. Ann. Inst. Pasteur. Microbiol. 139:605-612.[CrossRef][Medline]
20
20. Olsen, S. J., R. Bishop, F. W. Brenner, T. H. Roels, N. Bean, R. V. Tauxe, and L. Slutsker. 2001. The changing epidemiology of salmonella: trends in serotypes isolated from humans in the United States, 1987-1997. J. Infect. Dis. 183:753-761.[CrossRef][Medline]
21
21. Pangloli, P., Y. Dje, O. Ahmed, C. A. Doane, S. P. Oliver, and F. A. Draughon. 2008. Seasonal incidence and molecular characterization of Salmonella from dairy cows, calves, and farm environment. Foodborne Pathog. Dis. 5:87-96.[CrossRef][Medline]
22
22. Popoff, M. Y., J. Bockemuhl, and L. L. Gheesling. 2004. Supplement 2002 (no. 46) to the Kauffmann-White scheme. Res. Microbiol. 155:568-570.[Medline]
23
23. Porwollik, S., E. F. Boyd, C. Choy, P. Cheng, L. Florea, E. Proctor, and M. McClelland. 2004. Characterization of Salmonella enterica subspecies I genovars by use of microarrays. J. Bacteriol. 186:5883-5898.[Abstract/Free Full Text]
24
24. Porwollik, S., C. A. Santiviago, P. Cheng, L. Florea, and M. McClelland. 2005. Differences in gene content between Salmonella enterica serovar Enteritidis isolates and comparison to closely related serovars Gallinarum and Dublin. J. Bacteriol. 187:6545-6555.[Abstract/Free Full Text]
25
25. Reeves, M. W., G. M. Evins, A. A. Heiba, B. D. Plikaytis, and J. J. Farmer III. 1989. Clonal nature of Salmonella typhi and its genetic relatedness to other salmonellae as shown by multilocus enzyme electrophoresis, and proposal of Salmonella bongori comb. nov. J. Clin. Microbiol. 27:313-320.[Abstract/Free Full Text]
26
26. Reller, M. E., R. V. Tauxe, L. A. Kalish, and K. Molbak. 2007. Excess salmonellosis in women in the United States: 1968-2000. Epidemiol. Infect. 136:1109-1117.
27
27. Schrader, K., A. Fernandez-Castro, W. K. Cheung, C. M. Crandall, and S. Abbott. 2008. Evaluation of commercial antisera for Salmonella serotyping. J. Clin. Microbiol. 46:685-688.[Abstract/Free Full Text]
28
28. Shirakawa, T., B. Acharya, S. Kinoshita, S. Kumagai, A. Gotoh, and M. Kawabata. 2006. Decreased susceptibility to fluoroquinolones and gyrA gene mutation in the Salmonella enterica serovar Typhi and Paratyphi A isolated in Katmandu, Nepal, in 2003. Diagn. Microbiol. Infect. Dis. 54:299-303.[CrossRef][Medline]
29
29. Thorns, C. J. 2000. Bacterial food-borne zoonoses. Rev. Sci. Tech. 19:226-239.[Medline]
30
30. Tietjen, M., and D. Y. Fung. 1995. Salmonellae and food safety. Crit. Rev. Microbiol. 21:53-83.[Medline]
31
31. Uyttendaele, M., K. Vanwildemeersch, and J. Debevere. 2003. Evaluation of real-time PCR vs automated ELISA and a conventional culture method using a semi-solid medium for detection of Salmonella. Lett. Appl. Microbiol. 37:386-391.[CrossRef][Medline]
32
32. Vojdani, J. D., L. R. Beuchat, and R. V. Tauxe. 2008. Juice-associated outbreaks of human illness in the United States, 1995 through 2005. J. Food Prot. 71:356-364.[Medline]
33
33. Vugia, D. J., M. Samuel, M. M. Farley, R. Marcus, B. Shiferaw, S. Shallow, K. Smith, and F. J. Angulo. 2004. Invasive Salmonella infections in the United States, FoodNet, 1996-1999: incidence, serotype distribution, and outcome. Clin. Infect. Dis. 38(Suppl. 3):S149-S156.[CrossRef][Medline]

---

Journal of Clinical Microbiology, December 2008, p. 4018-4022, Vol. 46, No. 12
0095-1137/08/$08.00+0     doi:10.1128/JCM.01229-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

This Article Abstract Full Text (PDF) Supplemental material Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Woods, D. F. Articles by Boyd, E. F. Search for Related Content PubMed PubMed Citation Articles by Woods, D. F. Articles by Boyd, E. F.