![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Previous Article | Next Article 
Journal of Clinical Microbiology, March 2008, p. 1110-1112, Vol. 46, No. 3
0095-1137/08/$08.00+0 doi:10.1128/JCM.01974-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
Department of Microbiology and Clinical Microbiology, Cerrahpasa Faculty of Medicine, University of Istanbul, Istanbul 34303, Turkey,1 Department of Microbiology and Clinical Microbiology, Istanbul Faculty of Medicine, University of Istanbul, Istanbul 34300, Turkey,2 Department of Microbiology and Clinical Microbiology, Istanbul Faculty of Medicine, University of Istanbul, Istanbul 34300, Turkey,3 Department of Infectious, Parasitic and Immune-Mediated Diseases, Istituto Superiore di Sanitá, 00161 Rome, Italy,4 Department of Medical Microbiology, School of Medicine, Heath Hospital, University of Cardiff, Cardiff CF14 4XN, United Kingdom5
Received 5 October 2007/ Returned for modification 12 November 2007/ Accepted 26 December 2007
 |
ABSTRACT |
|---|
 Top ABSTRACT TEXTREFERENCES |
|---|
|
TEXT |
|---|
|
TopABSTRACTTEXTREFERENCES |
|---|
Data on the prevalence and distribution of CTX-M-type enzymes are very limited in Turkey. Two studies revealed that CTX-M enzymes were present and disseminated among Enterobacteriaceae family isolates in Turkey (1, 10). The aim of this study was to determine the current prevalence of the CTX-M-1 group and the molecular characteristics in E. coli clinical isolates in a university hospital in Istanbul, Turkey.
(This work was presented in part as a poster at the "Microbes in a Changing World" Congress of the International Union of Microbiological Societies (IUMS), San Francisco, CA, 23 to 28 July 2005.)
A total of 1,010 consecutive nonrepetitive isolates of E. coli obtained from inpatients and outpatients at the hospital of Istanbul Faculty of Medicine over a 2-year period (2002 to 2004) were screened for extended-spectrum β-lactamase (ESBL) production, using the double-disc synergy test. A total of 61 E. coli isolates (27 from inpatients and 34 from outpatients) with ESBL phenotypes were included in this study, the majority of which were from the urine and respiratory specimens of patients treated in six different medical and surgical wards.
MICs were determined by the agar dilution method. MICs for cefotaxime, ceftriaxone, and ceftazidime used alone and in combination were determined, with 4 µg/ml clavulanic acid for phenotypic detection of ESBLs.
Conjugation experiments for the transfer of cefotaxime resistance were carried out with all CTX-M-1-producing E. coli isolates (8). Crude extracts of β-lactamases were subjected to isoelectric focusing (IEF) (3).
All isolates were screened for the CTX-M-1 group (13) and blaTEM (16) and blaSHV (9). Strains which had pI bands at 7.3 were subjected to blaOXA-1-like PCR using the primers OXA-1-A (5'-GAATCGCATTATCACTTATGG-3') and OXA-1-B (5'-GATACATGTTCTCTATGG-3'; this study). PCR amplicons for linking ISEcp1 with blaCTX-M were obtained by anchoring one primer at the 3' end of blaCTX-M (blaCTX-M reverse, 5'CACTTTGTCGTCTAAGGCG3') and the other to the 5' end of ISEcp1 (5'AATACTACCTTGGCTTTCTGA3').
Sequencing was carried out with both strands by using the dideoxy chain termination method with a Perkin Elmer Biosystems 377 DNA sequencer. Sequence analysis was performed using a Lasergene DNASTAR software package. Sequence alignments were done using Clustal W software and a PAM 250 matrix.
After isoelectric focusing was carried out, a bioassay was assigned to visualize and confirm the hydrolytic activity of the enzymes detected by the isoelectric focusing (4).
Randomly amplified polymorphic DNA (RAPD) analyses were performed using an ERIC2 primer (7).
A subset of E. coli isolates had their plasmids fully characterized. Plasmids were isolated by the alkaline lysis method (12) and used to transform E. coli TOPO cells (Invitrogen, Paisley, United Kingdom) via electroporation. Transformants were checked by PCR for carriage of the CTX-M type 1 gene. Plasmids were restricted using EcoR1, their sizes were assessed (2), and they were typed according to the method described by Carattoli et al. (6). Initially, multiplex PCR was used and then refined, with single PCR used to obtain clear amplicons for sequencing.
Sixty-one (6%) out of the 1,010 E. coli isolates were found to be positive for the presence of ESBLs, in our study. There was a high rate of resistance against ciprofloxacin (80.4%). The most active antibiotics for ESBL-producing E. coli were amikacin (91.9%) and imipenem (100%).
The pI values of the β-lactamases and the PCR results for ESBL-encoding genes are shown in Table 1. All of the CTX-M-1-group-positive E. coli isolates were confirmed to possess cefotaxime-hydrolyzing activity in the subsequent bioassay experiments, corroborating the pI values with cefotaximase activity. Positive amplicons were sequenced, and all were shown to be blaCTX-M-15. As blaCTX-M-15 is ubiquitously associated with ISEcp1 (13, 14), the genetic context was sought by using the PCR strategy described previously. In all CTX-M-15-positive isolates, blaCTX-M-15 was found directly adjacent to the ISEcp1.
|
Plasmid analysis indicated that in all cases, the strains possessed more than one plasmid, with some strains possessing up to five. The presence of the blaCTX-M-15 genes in cefotaxime-resistant transconjugates were confirmed by PCR and sequencing. Once transconjugates were confirmed, they were randomly selected, and plasmids were isolated as described previously. Multiplex PCR was undertaken to determine the plasmid Inc/rep type, followed by simplex PCR as previously described (6, 11). In one isolate (Table 1, isolate 1), the blaCTX-M-15 gene was carried on a plasmid of approximately 65 kb and possessed an F1 Inc/rep type. The other plasmids (n = 17) that were typed possessed a large plasmid of approximately 140 kb, which possessed an Inc/rep type of FII (Table 1).
Data show that the isolation of the CTX-M-1-group-positive E. coli accounted for 86.8% of the ESBL-positive E. coli isolates. The abundance of different phenotypes and the presence of multiple different enzymes in each strain indicate that the epidemiology of ESBLs in our hospital is complex. The high clinical incidence of blaCTX-M-15 since 2004 suggests that the gene pool was well established prior to this date. Interestingly, the transconjugates demonstrating blaCTX-M-15 carriage were predominantly Inc/rep type FII but also type FI, and while the FII and blaCTX-M-15 relationship is well established, this is not the case with FI (11, 15).
The high prevalence of the CTX-M-15 group underlines the need for further surveillance and further investigation for better understanding of the epidemiology and the genetic background of this specific resistance trend, but the present results demonstrate that CTX-M-15 has emerged and spread in a very short period in our hospital.
|
ACKNOWLEDGMENTS |
|---|
We thank Mark Toleman for molecular analysis.
|
FOOTNOTES |
|---|
Published ahead of print on 9 January 2008.
|
REFERENCES |
|---|
|
TopABSTRACTTEXTREFERENCES |
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Antimicrob. Agents Chemother. | Clin. Microbiol. Rev. |
|---|---|
| Clin. Vaccine Immunol. | ALL ASM JOURNALS |
|---|
