This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tanaka, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tanaka, D.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, April 2008, p. 1526-1529, Vol. 46, No. 4
0095-1137/08/$08.00+0     doi:10.1128/JCM.02188-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Genetic Features of Clinical Isolates of Streptococcus dysgalactiae subsp. equisimilis Possessing Lancefield's Group A Antigen{triangledown}

Daisuke Tanaka,1* Junko Isobe,1 Masanori Watahiki,1 Yoshiyuki Nagai,1 Chihiro Katsukawa,2 Ryuji Kawahara,2 Miyoko Endoh,3 Rumi Okuno,3 Nanako Kumagai,4 Masakado Matsumoto,5 Yoshiro Morikawa,6 Tadayoshi Ikebe,7 Haruo Watanabe,7 and the Working Group for Group A Streptococci in Japan,{dagger}

Department of Bacteriology, Toyama Institute of Health, Toyama,1 Department of Infectious Diseases, Osaka Prefectural Institute of Public Health, Osaka,2 Department of Bacteriology, Tokyo Metropolitan Institute of Public Health, Tokyo,3 Department of Microbiology, Fukushima Institute of Public Health, Fukushima,4 Department of Microbiology, Aichi Prefectural Institute of Public Health, Aichi,5 Morikawa Pediatric Clinic, Osaka,6 Department of Bacteriology, National Institute of Infectious Diseases, Tokyo, Japan7

Received 13 November 2007/ Returned for modification 19 December 2007/ Accepted 19 February 2008


arrow
ABSTRACT
 
Thirteen Streptococcus dysgalactiae subsp. equisimilis isolates possessing Lancefield's group A antigen recovered from people in Japan during 2000 to 2004 were genotyped. The results indicate that a conserved clone has persisted and spread within Japan, and two different emm types were observed within members of this clone.


arrow
TEXT
 
Streptococcus dysgalactiae subsp. equisimilis belongs to Lancefield's groups C and G, and it has been recognized as a cause of pharyngitis and skin and soft-tissue infections (6, 10, 12, 27). Further, case reports referring to toxic shock-like syndrome (TSLS) due to group C and G S. dysgalactiae subsp. equisimilis have been published (2, 13, 16, 19, 20, 22, 28). Recently, some cases of bacteremia or gangrene caused by S. dysgalactiae subsp. equisimilis belonging to Lancefield's group A have been reported (5, 7, 18). These group A beta-hemolytic streptococci were identified as S. dysgalactiae subsp. equisimilis on the basis of the phylogenetic analysis of their 16S rRNA genes and their biochemical characters in spite of the common use of GAS (group A streptococcus) to describe S. pyogenes. Thus, these data have demonstrated that S. pyogenes is not the only beta-hemolytic streptococcus possessing the group A antigen. However, the genetic characterization of group A S. dysgalactiae subsp. equisimilis has not been fully studied.

GAS, GCS (group C streptococci), and GGS (group G streptococci) express various M-like proteins on the cell surface. On the basis of the sequence analysis of the 5' end of the emm gene that encodes the M-like protein, emm typing has been widely used to characterize these streptococci (3, 4, 13, 16, 17, 26). The Centers for Disease Control and Prevention (CDC) maintains the emm sequence database (http://www.cdc.gov/ncidod/biotech/strep/strepindex.htm) that contains >150 emm types of GAS and >30 emm types of GCS and GGS. Multilocus sequence typing (MLST) data are used to construct a model that analyzes the evolution of GAS, GCS, and GGS (17). In the present study, we collected and characterized group A S. dysgalactiae subsp. equisimilis isolates from humans, including TSLS patients. We performed epidemiological analysis of these isolates by using a combination of different genotyping methods, emm typing, and MLST.

Bacterial isolates. The clinical and epidemiological features of the 13 group A S. dysgalactiae subsp. equisimilis isolates collected in this study are listed in Table 1. All of these isolates were recently recovered from humans, and all of the isolates examined, except one, were associated with disease. Two isolates were recovered from TSLS patients. All of the isolates were confirmed to possess only the group A carbohydrate antigen with a Streptococcus Grouping kit (Oxoid Ltd., Basingstoke, United Kingdom) and Strept LA (Denka Seiken, Japan), and they were identified as S. dysgalactiae subsp. equisimilis by using the API 20 Strep kit (BioMérieux, Tokyo, Japan).


View this table:
[in this window]
[in a new window]

  		TABLE 1. Characteristics of group A S. dysgalactiae subsp. equisimilis isolated in Japan

16S rRNA gene sequencing. PCR template DNA was prepared by using InstaGene Matrix (Bio-Rad, Hercules, CA). DNA sequencing of the 16S rRNA genes was performed according to previously described methods (14, 15). The 16S rRNA gene was amplified with primers 27f (AGAGTTTGATCCTGGCTCAG) and 1492r (GGCTACCTTGTTACGACTT). Sequencing was performed with the ABI Prism 3100 genetic analyzer (Applied Biosystems, Foster City, CA) and primers r1L (GTATTACCGCGGCTGCTGG), r3L (TTGCGCTCGTTGCGGGACT), r4L (ACGGGCGGTGTGTACAAG), f1L (GAGTTTGATCCTGGCTCAG), f2L (CCAGCAGCCGCGGTAATAC), and 926f (AAACTCAAAGGAATTGACGG).

emm typing. emm typing was performed as described by Beall et al. (3, 4). The sequence was subjected to a homology search (Streptococci Group A Subtyping Request Form, BLAST 2.0 server [http://www.cdc.gov/ncidod/biotech/strep/strepblast.htm]), and the emm type was determined.

MLST. MLST was performed by determining the DNA sequences of the internal portions of seven housekeeping genes that encoded glucose kinase (gki), glutamine transport protein (gtr), glutamate racemase (murI), DNA mismatch repair protein (mutS), transketolase (recP), xanthine phosphoribosyltransferase (xpt), and acetyl coenzyme A acetyltransferase (yqiL); MLST was performed according to a previously described procedure for GCS and GGS isolates (17). The primer pairs for the gtr loci did not amplify the corresponding MLST target fragment for all of the isolates tested. It was possible that an alteration within primer annealing sites prevented amplification. Therefore, alternative primer pairs for the gtr loci were designed to generate appropriate PCR products on the basis of the sequence information from the S. equi subsp. equi genome sequence (www.sanger.ac.uk) and sequence analysis combined with the inverse PCR method (23). The alternative primers used were as follows: gtr(GAS-Sde)-up, 5'-GGTGATTATTGGCCCTTCTGG-3'; gtr(GAS-Sde)-dn, 5'-CGGTCTGCGACTTCTTTAGCA-3'.

Detection of virulence genes by PCR. PCR with previously described primer pairs was conducted for the detection of the genes coding for C5a peptidase (scpA), streptokinase (ska), streptolysin O (slo), streptolysin S (sagA), extracellular phospholipase A2 (sla), and streptococcal pyrogenic exotoxins (speA, speB, speC, speG, speH, speI, speJ, speL [M3], speL [M18], and speM) (16). In all cases, the primers were designed toward a sequence located inside the open reading frame. The expected sizes of PCR products were 759 bp for scpA, 237 bp for ska, 434 bp for slo, 113 bp for sagA, 495 bp for sla, 393 bp for speA, 1,113 bp for speB, 624 bp for speC, 211 bp for speG, 406 bp for speH, 523 bp for speI, 490 bp for speJ, 639 bp for speL [M3], 789 bp for speL [M18], and 672 bp for speM. PCR amplification was carried out by initial denaturation at 94°C for 2 min, followed by 30 cycles at 94°C for 30 s, 52°C for 30 s, and 72°C for 1 min and a final extension at 72°C for 3 min.

The 16S rRNA genes of all of the isolates tested showed completely identical DNA sequences (GenBank accession number AB253330). Two to three base differences existed between the 16S rRNA gene sequences of the isolates tested in this study and that of previously described group A S. dysgalactiae subsp. equisimilis strains (GenBank accession numbers AJ314609, AJ314610, and AJ314611); however, there was no difference between the 16S rRNA gene sequences of the isolates tested and the 5' region sequences of the 16S rRNA genes of group A S. dysgalactiae subsp. equisimilis strain (GenBank accession number AF239716).

All of the isolates possessed the same set of alleles in six of the seven housekeeping loci, namely, gki108, gtr106, murI105, mutS106, recP107, and xpt104 (GenBank accession numbers AF332633, AF332641, AF332801, AF330237, AF332816, and AF332829). These Japanese isolates were similar to GCS strain 4288 described by Kalia et al. (17) by MLST. The primer pairs for the yqiL loci did not amplify the corresponding MLST target fragment in any of the isolates tested. It was possible that an alteration within the primer annealing sites prevented amplification. Our attempts to make new primer pairs for the yqiL loci were unsuccessful. In the present study, the results of MLST and 16S rRNA gene sequencing of all of the isolates were completely identical. Our data indicate the dissemination of a single successful group A S. dysgalactiae subsp. equisimilis strain throughout at least four areas of Japan.

The emm types of the isolates tested are shown in Table 1. Of the 13 isolates, 11 were of the stg485 type and the remaining 2 were of the stg652 type. All of the stg485 isolates were of subtype stg485.0, and two stg652 isolates were of subtypes stg652.0 and stg652.5. stg652.5 was a new subtype with only one nucleotide difference from subtype stg652.0. These emm types were found to be associated with GGS isolates (http://www.cdc.gov/ncidod/biotech/strep/strepindex.htm). Both isolates from TSLS patients were of subtype stg485.0. Interestingly, Misawa et al. (21) reported that a group G S. dysgalactiae subsp. equisimilis isolate from a TSLS patient was of emm subtype stg485.0. These data suggest that this emm subtype strain should be kept in mind as a potential pathogen causing TSLS.

The presence of virulence genes was identified by PCR. All of the isolates showed the same virulence gene profile that was PCR positive for speG, scpA, ska, sagA, and slo and PCR negative for sla, speA, speB, speC, speH, speI, speJ, speL (M3), speL (M18), and speM. Previously, we reported that all 16 group G S. dysgalactiae subsp. equisimilis strains isolated from patients with severe invasive infections carried the scpA, ska, slo, and sagA genes (16). In this study, we observed that all group A S. dysgalactiae subsp. equisimilis strains also carried these four virulence genes and the speG gene. Misawa et al. (21) reported that a group G TSLS-causing strain possessed three virulence genes, slo, sagA, and skcg (ska). Perhaps some of these virulence genes might relate to pathogenesis of TSLS caused by group A or G S. dysgalactiae subsp. equisimilis.

To the best of our knowledge, this report describes the first case of TSLS caused by group A S. dysgalactiae subsp. equisimilis. Two case reports are summarized in Table 2. The ages of the patients were 54 and 70 years. At least one of the underlying conditions was reported in the patients (i.e., alcohol addiction and liver cirrhosis in case 1 and edema in case 2). In previous reports, the underlying conditions have been noted mostly in patients with infections due to S. dysgalactiae subsp. equisimilis possessing group A, C, or G antigen (5, 7, 13, 16, 18). The clinical manifestations included shock, hepatic insufficiency, renal failure, disseminated intravascular coagulation, erythematous rash, and soft-tissue necrosis.


View this table:
[in this window]
[in a new window]

  		TABLE 2. Features of TSLS caused by group A S. dysgalactiae subsp. equisimilis isolated in Japan

It has been suggested that the horizontal transfer of the emm sequences and the following recombination events occur among beta-hemolytic streptococci such as GAS, GCS, and GGS (1, 24, 25). Such a mechanism could be responsible for the development of gene mosaics and the evolution of the emm genes in beta-hemolytic streptococci (29). In the present study, two different emm types were observed among the 13 group A S. dysgalactiae subsp. equisimilis isolates that were recently isolated in Japan, although the results of MLST and 16S rRNA gene sequencing for all of these isolates were completely identical. These two emm types included 11 stg485 isolates obtained during 2000 to 2004 and two stg652 isolates obtained in 2004. Therefore, it appears that horizontal gene transfer has contributed to variations of the emm gene in group A S. dysgalactiae subsp. equisimilis.

Kalia et al. (17) performed MLST of 34 GCS and GGS strains obtained from humans; they obtained 34 unique combinations of allelic profiles (sequence types). Of these 34 strains, stain 4288 was the most closely related to our isolates. Strain 4288 shares six of the seven housekeeping alleles, carries the Lancefield group C antigen, and belongs to the stg485 type. It is entirely possible that the Japanese isolates have all seven MLST sequences in common since the corresponding MLST target site (yqiL) was not amplified and sequenced by an alteration within a primer annealing site(s). Of our 13 group A S. dysgalactiae subsp. equisimilis isolates, 11 belonged to the same emm type. Therefore, these findings indicate that strain 4288 and our isolates may have been derived from the same ancestor or member of the clonal complex, even though they show different group antigens. Further, the basic polysaccharide structure in both groups A and C comprises polymeric L-rhamnose; this indicates a close relationship (8). Moreover, Kalia et al. (17) estimated that interspecies recombinational exchanges from GAS donors to GCS-GGS recipients had occurred recently. Therefore, the lateral transfer of the gene responsible for producing group antigens might cause a change in the group antigen. Recently, the complete genome sequences of several streptococcal species have been reported, and a brief description of each has been presented (11). S. pneumoniae and S. mutans have highly developed transformation systems, whereas natural transformation is not known to be a common event in S. pyogenes or S. agalactiae. Although S. pyogenes and S. agalactiae have many genes that are essential for competence and transformation, they have lost competence probably because phages have assumed a more important role in population diversity. It is possible that S. dysgalactiae subsp. equisimilis may have its origin in S. pyogenes (9). Therefore, phage-mediated genetic transfer is, in fact, the likely mechanism in S. dysgalactiae subsp. equisimilis, although the complete genome of this species has not been obtained.

In the present study, we investigated the phylogenetic relationship among 13 group A S. dysgalactiae subsp. equisimilis isolates by using several different genotyping methods. Our data suggest that all of the group A S. dysgalactiae subsp. equisimilis isolates recovered from Japanese patients could have descended from a common ancestor. Further investigation is required to elucidate the epidemiology of S. dysgalactiae subsp. equisimilis possessing Lancefield's group A antigen.

Nucleotide sequence accession number. The 16S rRNA gene sequence of strain NIH245 has been deposited in the DDBJ database under accession number AB253330. The new emm subtype was deposited in the CDC emm sequence database.


arrow
ACKNOWLEDGMENTS
 
The following are the members of the Working Group for GAS in Japan: S. Saito, Akita Prefectural Institute of Public Health, Akita; K. Ootani, Yamagata Prefectural Institute of Public Health, Yamagata; M. Oguro, Sendai City Institute of Public Health, Sendai; J. Fujisaki, Niigata Prefectural Research Institute for Health and Environmental Sciences, Niigata; K. Sugama and K. Hirasawa, Fukushima Prefectural Institute of Public Health, Fukushima; J. Isobe and D. Tanaka, Toyama Institute of Health, Toyama; M. Matsumoto, Aichi Prefectural Institute of Public Health, Nagoya; M. Sakaki, Hiroshima Prefectural Institute of Public Health and Environment, Hiroshima; Y. Kasama, Hiroshima City Institute of Public Health, Hiroshima; H. Tanaka, Ehime Prefectural Institute of Public Health and Environmental Science, Ehime; C. Sunahara, Kagawa Prefectural Institute of Public Health, Kagawa; T. Yasuoka, Public Health Institute of Kochi Prefecture, Kochi; T. Shimizi, Tokushima Prefectural Institute of Public Health and Environmental Sciences, Tokushima; S. Moroishi, Saga Prefectural Institute of Public Health, Saga; Y. Abe and K. Ogata, Oita Prefectural Institute of Health and Environment, Oita; J. Kudaka, Okinawa Prefectural Institute of Health and Environment, Okinawa; T. Ikebe and H. Watanabe, National Institute of Infectious Diseases, Tokyo; M. Endoh and R. Okuno, Tokyo Metropolitan Institute of Public Health, Tokyo; R. Suzuki, Kanagawa Prefectural Public Health Laboratory, Kanagawa; C. Katsukawa and R. Kawahara, Osaka Prefectural Institute of Public Health, Osaka; and M. Tomita, Yamaguchi Prefectural Research Institute of Public Health, Yamaguchi.

We thank T. Karasawa (Kanazawa University) for helpful comments.


arrow
FOOTNOTES
 
* Corresponding author. Present address: Graduate School of Science and Engineering, University of Toyama, 3190 Gofuku, Toyama 930-8555, Japan. Phone: 81-76-445-6673. Fax: 81-76-445-6549. E-mail: tanakada{at}sci.u-toyama.ac.jp Back

{triangledown} Published ahead of print on 27 February 2008. Back

{dagger} The members of the Working Group for GAS in Japan are listed in Acknowledgments. Back


arrow
REFERENCES
 
    1
  1. Albertí, S., C. Garcia-Rey, M. I. Garcia-Laorden, R. Dal-Re, J. Garcia-de-Lomas, and the Spanish Surveillance Group for Respiratory Pathogens. 2005. Survey of emm-like gene sequences from pharyngeal isolates of group C and group G streptococci collected in Spain. J. Clin. Microbiol. 43:1433-1436.[Abstract/Free Full Text]
    2. 2
  2. Barnham, M. R., N. C. Weightman, A. W. Anderson, and A. Tanna. 2002. Streptococcal toxic shock syndrome: a description of 14 cases from North Yorkshire, UK. Clin. Microbiol. Infect. 8:174-181.[CrossRef][Medline]
    3. 3
  3. Beall, B., R. Facklam, T. Hoenes, and B. Schwartz. 1997. Survey of emm gene sequences and T-antigen types from systemic Streptococcus pyogenes infection isolates collected in San Francisco, California; Atlanta, Georgia; and Connecticut in 1994 and 1995. J. Clin. Microbiol. 35:1231-1235.[Abstract]
    4. 4
  4. Beall, B., R. Facklam, and T. Thompson. 1996. Sequencing emm-specific PCR products for routine and accurate typing of group A streptococci. J. Clin. Microbiol. 34:953-958.[Abstract]
    5. 5
  5. Bert, F., and N. Lambert-Zechovsky. 1997. Analysis of a case of recurrent bacteraemia due to group A Streptococcus equisimilis by pulsed-field gel electrophoresis. Infection 25:250-251.[CrossRef][Medline]
    6. 6
  6. Bisno, A. L., C. M. Collins, and J. C. Turner. 1996. M proteins of group C streptococci isolated from patients with acute pharyngitis. J. Clin. Microbiol. 34:2511-2515.[Abstract]
    7. 7
  7. Brandt, C. M., G. Haase, N. Schnitzler, R. Zbinden, and R. Lutticken. 1999. Characterization of blood culture isolates of Streptococcus dysgalactiae subsp. equisimilis possessing Lancefield's group A antigen. J. Clin. Microbiol. 37:4194-4197.[Abstract/Free Full Text]
    8. 8
  8. Coligan, J. E., T. J. Kindt, and R. M. Krause. 1978. Structure of the streptococcal groups A, A-variant and C carbohydrates. Immunochemistry 15:755-760.[CrossRef][Medline]
    9. 9
  9. Davies, M. R., D. J. McMillan, G. H. Van Domselaar, M. K. Jones, and K. S. Sriprakash. 2007. Phage 3396 from a Streptococcus dysgalactiae subsp. equisimilis pathovar may have its origins in Streptococcus pyogenes. J. Bacteriol. 189:2646-2652.[Abstract/Free Full Text]
    10. 10
  10. Efstratiou, A., E. L. Teare, D. McGhie, and G. Colman. 1989. The presence of M proteins in outbreak strains of Streptococcus equisimilis T-type 204. J. Infect. 19:105-111.[CrossRef][Medline]
    11. 11
  11. Ferretti, J. J., D. Ajdic, and W. M. McShan. 2004. Comparative genomics of streptococcal species. Indian. J. Med. Res. 119(Suppl.):1-6.[Medline]
    12. 12
  12. Fox, K., J. Turner, and A. Fox. 1993. Role of beta-hemolytic group C streptococci in pharyngitis: incidence and biochemical characteristics of Streptococcus equisimilis and Streptococcus anginosus in patients and healthy controls. J. Clin. Microbiol. 31:804-807.[Abstract/Free Full Text]
    13. 13
  13. Hashikawa, S., Y. Iinuma, M. Furushita, T. Ohkura, T. Nada, K. Torii, T. Hasegawa, and M. Ohta. 2004. Characterization of group C and G streptococcal strains that cause streptococcal toxic shock syndrome. J. Clin. Microbiol. 42:186-192.[Abstract/Free Full Text]
    14. 14
  14. Hiraishi, A. 1992. Direct automated sequencing of 16S rDNA amplified by polymerase chain reaction from bacterial cultures without DNA purification. Lett. Appl. Microbiol. 15:210-213.[Medline]
    15. 15
  15. Hiraishi, A., Y. K. Shin, Y. Ueda, and J. Sugiyama. 1994. Automated sequencing of PCR-amplified 16S rDNA on ‘Hydrolink’ gels. J. Microbiol. Methods 19:145-154.[CrossRef]
    16. 16
  16. Ikebe, T., S. Murayama, K. Saitoh, S. Yamai, R. Suzuki, J. Isobe, D. Tanaka, C. Katsukawa, A. Tamaru, A. Katayama, Y. Fujinaga, K. Hoashi, H. Watanabe, and the Working Group for Streptococci in Japan. 2004. Surveillance of severe invasive group-G streptococcal infections and molecular typing of the isolates in Japan. Epidemiol. Infect. 132:145-149.[CrossRef][Medline]
    17. 17
  17. Kalia, A., M. C. Enright, B. G. Spratt, and D. E. Bessen. 2001. Directional gene movement from human-pathogenic to commensal-like streptococci. Infect. Immun. 69:4858-4869.[Abstract/Free Full Text]
    18. 18
  18. Katsukawa, C., A. Tamaru, and Y. Morikawa. 2002. Streptococcus dysgalactiae subsp. equisimilis possessing Lancefield's group A antigen. Kansenshogaku Zasshi 76:155-160.[Medline]
    19. 19
  19. Keiser, P., and W. Campbell. 1992. ‘Toxic strep syndrome’ associated with group C Streptococcus. Arch. Intern. Med. 152:882-884.[Abstract/Free Full Text]
    20. 20
  20. Kugi, M., H. Tojo, I. Haraga, T. Takata, K. Handa, and K. Tanaka. 1998. Toxic shock-like syndrome caused by group G Streptococcus. J. Infect. 37:308-309.[Medline]
    21. 21
  21. Misawa, Y., S. Okugawa, K. Ubukata, K. Okuzumi, M. Okada, K. Moriya, and K. Koike. 2006. A case of severe necrotizing cellulitis caused by group G Streptococcus dysgalactiae subsp. equisimilis. Kansenshogaku Zasshi 80:436-439.[Medline]
    22. 22
  22. Roth, S., K. Andrassy, K. H. Schmidt, E. Gunther, and E. Ritz. 1999. Febrile lady with acute renal failure and desquamating erythema. Am. J. Kidney Dis. 34:150-154.[Medline]
    23. 23
  23. Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
    24. 24
  24. Schnitzler, N., A. Podbielski, G. Baumgarten, M. Mignon, and A. Kaufhold. 1995. M or M-like protein gene polymorphisms in human group G streptococci. J. Clin. Microbiol. 33:356-363.[Abstract]
    25. 25
  25. Simpson, W. J., J. M. Musser, and P. P. Cleary. 1992. Evidence consistent with horizontal transfer of the gene (emm12) encoding serotype M12 protein between group A and group G pathogenic streptococci. Infect. Immun. 60:1890-1893.[Abstract/Free Full Text]
    26. 26
  26. Tanaka, D., Y. Gyobu, H. Kodama, J. Isobe, S. Hosorogi, Y. Hiramoto, T. Karasawa, and S. Nakamura. 2002. emm typing of group A streptococcus clinical isolates: identification of dominant types for throat and skin isolates. Microbiol. Immunol. 46:419-423.[Medline]
    27. 27
  27. Turner, J. C., A. Fox, K. Fox, C. Addy, C. Z. Garrison, B. Herron, C. Brunson, and G. Betcher. 1993. Role of group C beta-hemolytic streptococci in pharyngitis: epidemiologic study of clinical features associated with isolation of group C streptococci. J. Clin. Microbiol. 31:808-811.[Abstract/Free Full Text]
    28. 28
  28. Wagner, J. G., P. M. Schlievert, A. P. Assimacopoulos, J. A. Stoehr, P. J. Carson, and K. Komadina. 1996. Acute group G streptococcal myositis associated with streptococcal toxic shock syndrome: case report and review. Clin. Infect. Dis. 23:1159-1161.[Medline]
    29. 29
  29. Whatmore, A. M., and M. A. Kehoe. 1994. Horizontal gene transfer in the evolution of group A streptococcal emm-like genes: gene mosaics and variation in Vir regulons. Mol. Microbiol. 11:363-374.[CrossRef][Medline]

Journal of Clinical Microbiology, April 2008, p. 1526-1529, Vol. 46, No. 4
0095-1137/08/$08.00+0     doi:10.1128/JCM.02188-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tanaka, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tanaka, D.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»