Correction for Xie et al., J. Clin. Microbiol. 44 (12) 4316-4325.
This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xie, J.
Right arrow Articles by Marrs, C. F.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Xie, J.
Right arrow Articles by Marrs, C. F.

 Previous Article

Journal of Clinical Microbiology, April 2008, p. 1576, Vol. 46, No. 4
0095-1137/08/$08.00+0     doi:10.1128/JCM.00125-08

AUTHOR'S CORRECTION

Identification of New Genetic Regions More Prevalent in Nontypeable Haemophilus influenzae Otitis Media Strains than in Throat Strains

Jingping Xie, Patricia C. Juliao, Janet R. Gilsdorf, Debashis Ghosh, Mayuri Patel, and Carl F. Marrs

Department of Epidemiology, University of Michigan School of Public Health, Ann Arbor, Michigan; Department of Pediatrics and Communicable Diseases, University of Michigan Medical School, Ann Arbor, Michigan; and Department of Biostatistics, University of Michigan School of Public Health, Ann Arbor, Michigan

Volume 44, no. 12, p. 4316-4325, 2006. Page 4317, column 1, lines 40-41: "(primer BF1, GCAGAATTCAAAGCACAATTTGTTGCA" should read "(primer BF1, TGAATAACGAGGGGCAATATAAC."

Journal of Clinical Microbiology, April 2008, p. 1576, Vol. 46, No. 4
0095-1137/08/$08.00+0     doi:10.1128/JCM.00125-08





This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xie, J.
Right arrow Articles by Marrs, C. F.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Xie, J.
Right arrow Articles by Marrs, C. F.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»