This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fukushima, K. Y.
Right arrow Articles by Kamihira, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fukushima, K. Y.
Right arrow Articles by Kamihira, S.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, July 2008, p. 2384-2388, Vol. 46, No. 7
0095-1137/08/$08.00+0     doi:10.1128/JCM.00051-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Rapid Identification of Penicillin and Macrolide Resistance Genes and Simultaneous Quantification of Streptococcus pneumoniae in Purulent Sputum Samples by Use of a Novel Real-Time Multiplex PCR Assay{triangledown} ,{dagger}

Kazuko Y. Fukushima,1 Katsunori Yanagihara,1* Yoichi Hirakata,2 Kazuyuki Sugahara,1 Yoshitomo Morinaga,1,2 Shigeru Kohno,2 and Shimeru Kamihira1

Department of Laboratory Medicine,1 Second Department of Internal Medicine, Nagasaki University Graduate School of Biomedical Sciences, 1-7-1 Sakamoto, Nagasaki City 852-8501, Japan2

Received 10 January 2008/ Returned for modification 3 March 2008/ Accepted 29 April 2008


arrow
ABSTRACT
 
We evaluated a real-time quantitative PCR combined with a multiplex PCR assay for the quantification of Streptococcus pneumoniae and the simultaneous detection of drug-resistant genes by gel-based PCR, using purulent sputum samples. This assay correctly quantified S. pneumoniae and identified their penicillin and erythromycin susceptibilities directly from samples within 3 h.


arrow
TEXT
 
Streptococcus pneumoniae is a crucial pathogen that causes community-acquired pneumonia (CAP). CAP in adults is often treated with a combination of β-lactam antibiotics and macrolides (18, 22). However, alarmingly high frequencies of penicillin- and macrolide-resistant pneumococci have been reported, especially in several Asian countries, including Japan (4, 24, 30). The resistance of S. pneumoniae to penicillin has been shown to be closely associated with mosaic mutations in the pbp1a, pbp2b, and pbp2x genes (12, 35). Macrolide resistance is generally mediated by two mechanisms: 23S rRNA methylation encoded by the erm(B) gene or macrolide efflux via the mef(A) gene (23, 32). Detection of drug-resistant S. pneumoniae by classical techniques usually takes several days (17, 27). Recently, the utility of the real-time PCR method in the detection and quantification of S. pneumoniae has been examined using lower respiratory tract samples (2, 5, 15, 20, 36). The results of these studies suggest that clinical infection correlates with increased pneumococcal load, and these studies also mentioned the capacity of quantitative real-time PCR to distinguish between colonization and true infection (15, 36). Many investigators have evaluated the accuracy of multiplex PCR methods, which are used in the screening of S. pneumoniae strains demonstrating penicillin and macrolide resistance (13, 14, 21, 33, 34). Most of these assays, however, require separate tubes, are only able to detect two or three gene fragments, and have not been evaluated for clinical respiratory tract samples. In the present study, we developed a simultaneous single-tube real-time quantitative PCR combined with a multiplex PCR (RQ-mPCR) assay that rapidly quantifies S. pneumoniae; identifies alterations in pbp1a, pbp2b, and pbp2x genes; and detects the presence of erm(B) and mef(A) genes. We first verified this method by using clinical S. pneumoniae strains and then evaluated the effectiveness of the method using purulent sputum samples.

We used 200 clinical isolates of S. pneumoniae screened by optochin susceptibility (susceptible) and bile solubility (soluble) that were collected from April 2004 to March 2006 by a laboratory at the Nagasaki University Hospital. Strains were propagated on 5% sheep blood agar (Nissui Co., Ltd., Tokyo, Japan) at 37°C with 5% CO2. A mixture of 24 bacterial species from the American Type Culture Collection (ATCC; see Table S1 in the supplemental material) were selected from species commonly isolated from respiratory tract and from species that are genetically related to S. pneumoniae (3). In addition, 17 clinical strains of Streptococcus mitis and 12 clinical strains of Streptococcus oralis, which had been isolated from respiratory tract samples, were collected for cross-reactivity studies.

The MICs were determined by using broth microdilution techniques as described by the Clinical and Laboratory Standards Institute (CLSI) guidelines (7, 8). S. pneumoniae ATCC 49619 was used for quality control.

A total of 200 purulent sputum samples, which were collected from April 2004 to March 2005 and from June 2007 to August 2007 by a laboratory at the Nagasaki University Hospital, were used. Only good-quality sputum samples (P2 and P3 according to the classification of Miller and Jones (19) were used. Sputum samples were diluted 1:100 and 1:10,000 with 0.45% sodium chloride and treated with Sputazyme solution (Kyokuto Pharmaceutical Industries Co., Ltd., Tokyo, Japan). The diluted samples were spread on 5% sheep blood agar plates with a DS500 spiral plater (InterScience, Inc., Markham, Ontario, Canada) and then incubated at 37°C in 5% CO2. Optochin sensitivity and bile solubility were used to identify S. pneumoniae. Nucleic acids were isolated from clinical strains and sputum samples by using a QIAamp DNA blood minikit (Qiagen, Hilden, Germany).

The lytA, pbp1a, pbp2b, pbp2x, ermB, and mefA genes were amplified by PCR. Primers LytA-F and LytA-R and probes LytA-DCR and LytA-ACR were designed to target a 173-bp fragment of the single copy autolysin (lytA) gene of S. pneumoniae and were gleaned from published sequence (26). The primers for amplification of the pbp1a, pbp2b, and pbp2x genes were newly designed as follows: pbp1a (353 bp), 5'-1709AGTATATCAAGAACACTGGCTACG1732 and 5'-2061GCTTGGAGTGGTTGAGCTA2079-3'; pbp2b (442 bp), 5'-1291AAATTGGCATATGGATCTTTTC1312-3' and 5'-1732TATTCATCTCTGTCGGTTGC1751-3'; and pbp2x (339 bp), 5'-990AAGTAACTATGAACCAGGATCAG1012-3' and 5'-1388CGAAGCATTTGTGTTTGTGT1407-3'. The resistance pbp1a primers were designed to target four amino acid substitutions (Thr-574->Asn, Ser-575->Thr, Gln-576->Gly, and Phe-577->Thr) that are common to all penicillin G (PCG)-intermediate and -resistant isolates (29). The resistance pbp2x primers were designed to target amino acid substitutions in the 337STMK motif, and the resistance pbp2b primers were designed to target amino acid substitutions close to the 448SSN motif (25, 28). The primers for amplification of the ermB (224-bp) and mefA (294-bp) genes were gleaned from a published sequence (21). All of the primers used for RQ-mPCR had almost identical annealing temperatures (range, from 59.0 to 62.5°C), which reduces the occurrence of unwanted bands originating from nonspecific amplification. The PCR product amplified from S. pneumoniae ATCC 49619 using the LytA-F and LytA-R primer set was ligated into the pTAC-1 plasmid vector (BioDynamics, Tokyo, Japan) by using the TA PCR cloning technique. Plasmid standards containing 2.9 x 106 to 2.9 x 100 copies/µl were prepared by diluting the plasmid extracts in water. The standard curve was generated and exported by using LightCycler software (v3.5). PCR was performed on a LightCycler instrument. The final 20-µl single-tube reaction mixture contained 2x LightCycler FastStart DNA Master HybProbe (Roche Diagnostics, Basal, Switzerland), 5 mM MgCl2, 0.5 µM concentrations of each primer (LytA-F, LytA-R, pbp1a-F, pbp1a-R, pbp2b-F, pbp2b-R, pbp2x-F, pbp2x-R, mef-F, mef-R, erm-F, and erm-R), 0.2 µM concentrations of each hybridization probe (LytA-DCR and LytA-ACR), and 2 µl of DNA template. The cycling conditions were as follows: 95°C for 10 min, followed by 40 cycles of 95°C for 5 s, 60°C for 10 s, and 72°C for 15 s. All runs included a negative control of water and a calibrator/positive control of 2.9 x 106 copies of the plasmid/µl used for the standard curve. The data were analyzed by using LightCycler Software (v3.5) in the F2/F1 mode with a fit point calculation method. After amplification, 10 µl of the PCR product was separated by electrophoresis on a 3% agarose gel (Cambrex BioScience/Rockland, Inc., Rockland, ME) for 30 min at 100 V. The positions of DNA fragments are shown in Fig. 1A, lane M (100-bp ladder; Amersham Biosciences). Figure 1B shows the presence of the amplified products after agarose gel electrophoresis when DNA was extracted from representative PCG- and erythromycin (EM)-resistant S. pneumoniae strains (lane 1, ATCC 49619 (MICs of PCG = 0.25 µg/ml and EM < 0.5 µg/ml); lane 2, clinical strain 4808/S (MICs of PCG < 0.015 µg/ml and EM < 0.5 µg/ml); lane 3, clinical strain 1512/F (MICs of PCG = 0.03 µg/ml and EM = 2 µg/ml); lane 4, clinical strain 1565/F (MICs of PCG = 0.03 µg/ml and EM = 32 µg/ml); lane 5, clinical strain 8315/F (MICs of PCG = 0.12 µg/ml and EM = 0.5 µg/ml); lane 6, clinical strain 4827/F (MIC of PCG = 0.12 µg/ml and EM = 32 µg/ml); lane 7, clinical strain 8605/Z (MICs of PCG = 8 µg/ml and EM < 0.5 µg/ml); lane 8, clinical strain 8729/Z (MICs of PCG = 4 µg/ml and EM = 8 µg/ml); lane 9, clinical strain 1824/F (MICs of PCG = 2 µg/ml and EM = 16 µg/ml); lane M, 100-bp ladder).


Figure 1
View larger version (50K):
[in this window]
[in a new window]

 
FIG. 1. New multiplex PCR assay for simultaneous detection of lytA, penicillin resistance genes (altered pbp1a, pbp2x, and pbp2b), and macrolide resistance genes [erm(B) and mef(A)]. (A) Comparison of single-target versus multiplex PCRs using "resistant" control strain 1824/F. Lane M, 100-bp ladder (Amersham Biosciences). (B) Agarose gel electrophoresis of PCR products amplified with RQ-mPCR using control strains. Lane 1, ATCC 49619 (MICs of 0.25 µg/ml for PCG and <0.5 µg/ml for EM); lane 2, clinical strain 4808/S (MICs of <0.015 µg/ml for PCG and <0.5 µg/ml for EM); lane 3, clinical strain 1512/F (MICs of 0.03 µg/ml for PCG and 2 µg/ml for EM); lane 4, clinical strain 1565/F (MICs of 0.03 µg/ml for PCG and 32 µg/ml for EM); lane 5, clinical strain 8315/F (MICs of 0.12 µg/ml for PCG and 0.5 µg/ml for EM); lane 6, clinical strain 4827/F (MICs of 0.12 µg/ml for PCG and 32 µg/ml for EM); lane 7, clinical strain 8605/Z (MICs of 8 µg/ml for PCG and <0.5 µg/ml for EM); lane 8, clinical strain 8729/Z (MICs of 4 µg/ml for PCG and 8 µg/ml for EM); lane 9, clinical strain 1824/F (MICs of 2 µg/ml for PCG and 16 µg/ml for EM); lane M, 100-bp ladder (Amersham Biosciences).

Six, S. pneumoniae ATCC strains were all positive for the lytA gene. None of the DNA extracts (≥10 ng/µl) from 47 nonpneumococcal organisms (including 17 clinical isolates of S. mitis and 12 clinical isolates of S. oralis) cross-react with the primer-probe set, showing that the lytA primer-probe set was 100% specific for detecting S. pneumoniae strains. We used S. pneumoniae ATCC 49619 (positive for lytA and pbp1a), S. pneumoniae clinical strain 4808/S (positive for lytA only) and S. pneumoniae clinical strain 1824/F [positive for lytA, erm(B), mef(A), pbp1a, pbp2x, and pbp2b] to examine the analytical sensitivity of S. pneumoniae quantification by RQ-mPCR (see Fig. S1A in the supplemental material). The detection limit of lytA quantification was 20 copies/assay (10 copies/µl), which corresponds to 5 x 102 CFU/ml. To verify the analytical sensitivities of drug resistance genes in RQ-mPCR, we used S. pneumoniae clinical strain 1824/F and assessed the appearance of PCR products by gel electrophoresis (see Fig. S1B in the supplemental material). The detection limits of the five drug-resistant genes were between 5.8 x 101 and 5.8 x 102 copies/assay (between 103 and 104 CFU/ml). To validate the RQ-mPCR technique, all of the 200 S. pneumoniae strains that were tested by RQ-mPCR were also screened for the presence of individual resistance genes by a single PCR using the PCR conditions described above. The results of the two methods were in full agreement (data not shown), suggesting that the multiplex PCR primer sets are reliable. The RQ-mPCR results of 200 S. pneumoniae strains and the MIC distribution of PCG and EM are shown in Tables 1 and 2. All of the 200 strains were positive for the lytA gene. The multiplex PCR correctly identified penicillin susceptibility (MIC ≤ 0.06 µg/ml) or nonsusceptibility (MIC ≥ 0.12 µg/ml) in 189 (94.5%) of 200 isolates evaluated. The sensitivity, specificity, positive predictive values, and negative predictive values of our assay were 98.1% (103/105), 90.5% (86/95), 91.9% (103/112), and 97.7% (86/88), respectively. Our assay also correctly identified EM susceptibility (MIC ≤ 0.5 µg/ml) or resistant (MIC ≥ 1 µg/ml) in 200 (100%) out of 200 isolates evaluated. All of these isolates yielded 100% sensitivity, 100% specificity, 100% positive predictive values, and 100% negative predictive values.


View this table:
[in this window]
[in a new window]

 
TABLE 1. RQ-mPCR results and PCG MICs in 200 pneumococcal isolatesa


View this table:
[in this window]
[in a new window]

 
TABLE 2. RQ-mPCR results and EM MICs in 200 pneumococcal isolatesa

Of 200 purulent sputum samples, 56 samples were S. pneumoniae positive, and the remaining 144 samples were S. pneumoniae negative as determined by the conventional culture method. All 56 S. pneumoniae-positive samples were also positive for the lytA gene, and 143 of the 144 S. pneumoniae-negative samples were negative for the lytA gene. Therefore, the sensitivity and specificity for the identification of S. pneumoniae using purulent sputum samples in RQ-mPCR compared to the conventional culture method were 100% (56/56) and 99.3% (143/144), respectively. The correlation between the conventional culture counts and the level of lytA gene expression by RQ-mPCR using the 56 pneumococcal culture-positive sputum samples is shown in Fig. S2 in the supplemental material.

The penicillin- and macrolide-resistant genes detected by RQ-mPCR in purulent sputum samples are shown in Table 3. We compared these results to those in isolated S. pneumoniae from the same sputum samples. Of 56 pneumococcal culture-positive sputum samples, all were positive for lytA gene, and for 51 samples the detected genes were in complete agreement with the isolated S. pneumoniae. For the remaining five samples, the genes were not in complete agreement with the isolated S. pneumoniae: two samples were false positives for erm(B); one sample was false positive for mef(A), pbp1a, pbp2x, and pbp2b; one sample was false positive for pbp2x and pbp2b; and one sample was false positive for mef(A) and false negative for pbp1a. The sensitivities and specificities of this assay for detecting genes directly from sputum samples relative to isolated S. pneumoniae were 100 and 93.9% for erm(B), 100 and 94.8% for mef(A), 94.4 and 97.5% for pbp1a, 100 and 94.1% for pbp2x, and 100 and 95.6% for pbp2b, respectively. With regard to the 144 pneumococcal culture-negative sputum samples, the detection rates of drug resistant genes were 0% for pbp1a, 2.7% (4/144) for pbp2x, 1.4% (2/144) for pbp2b, 20.8% (30/144) for erm(B), and 11.1% (16/144) for mef(A).


View this table:
[in this window]
[in a new window]

 
TABLE 3. Comparison of RQ-mPCR results between in pneumococcal positive sputum samples and in S. pneumoniae isolates

Microorganisms closely related to S. mitis and harboring lytA gene, which are classically associated with S. pneumoniae, have been reported previously (37). However, positive results were not obtained from the mitis group of streptococci (including our collected clinical strains of 17 S. mitis and 12 S. oralis) that were tested for cross-reactivity in the present study. Compared to past reports (13, 14, 21, 34, 35), we obtained lower pbp2b detection rates in PCG-intermediate S. pneumoniae strains. This may have been due to a difference in the regions targeted by the pbp2b primers. The PCR results of macrolide-resistant genes in the present study matched previous report using the same primers (21), and they were also consistent with reports using other primers (11, 31). Although the analytical sensitivities of resistance genes on gel electrophoresis were lower than those seen with lytA quantification, the detection limit of 103 to 104 CFU/ml in resistant strains is within the permissible range for use with clinical samples, including bronchoalveolar fluid, which requires a diagnostic sensitivity for pathogens in excess of 104 CFU/ml (1, 9). With regard to one sputum sample which showed a false positive for the lytA gene, the RQ-mPCR assay (confirmed repeatedly) showed the presence of 104 CFU of S. pneumoniae/ml, and this specimen grew to 2 x 107 CFU of Staphylococcus aureus/ml by the culture method. This discrepancy may have resulted from a failure to detect S. pneumoniae that was surrounded by S. aureus and/or have resulted from the detection of atypical S. mitis or S. oralis, both of which harbor the lytA gene (37).

A discrepancy in RQ-mPCR specificity for samples 102/5F01 [false positive for mef(A)], 107/5F23 (false positive for pbp2x and pbp2b), 113/5F28 [false positive for mef(A), pbp1a, pbp2x, and pbp2b], and 101/6S11 and 101/6D13 [false positive for erm(B)] was confirmed by single PCR. This discrepancy indicates the presence of similar resistance genes in other microorganisms in the sputum samples. Avoiding these problems with cross-reactivity is difficult because the mosaic genes that encode altered, low-affinity pbp genes are considered products of recombination events involving horizontal transfer from closely related species (10, 16) and also because erm(B) and mef(A) macrolide-resistant genes in S. pneumoniae are highly homologous to genes in other Streptococcus-related species (6). In sample 102/5F01, pbp1a was detected by a single PCR, suggesting that the discrepancy in sensitivity (false negative) was due to the presence of PCR inhibitors or to a decline of sensitivity in this sputum sample. Although the sensitivity and specificity rates of our assay for sputum samples were in general satisfactory, further investigations are needed to remove PCR inhibitors from samples and to increase the sensitivity of the assay. Although our RQ-mPCR assay showed high correlation between the conventional culture counts and the level of lytA gene expression, further data from patients with pneumonia are needed to evaluate and interpret the results of our assay.

In summary, the RQ-mPCR method developed here had high sensitivity and specificity for pneumococci and could detect drug resistance in both clinical S. pneumoniae strains and sputum samples. Furthermore, the results can be obtained directly from clinical samples within 3 h (2 h for DNA extraction and preparation of PCR mixture and 1 h for PCR assay and electrophoresis), and this assay requires only a single tube. This method may be helpful for the rapid screening of resistance in pneumococcal isolates and should allow the administration of earlier, more focused and effective treatment of drug-resistant S. pneumoniae.


arrow
ACKNOWLEDGMENTS
 
We thank Daiichi Sankyo Co., Ltd., for providing 10 clinical strains (8 strains of S. mitis and 2 strains of S. oralis), and we also thank Astellas Pharma, Inc., for providing 19 clinical strains (9 strains of S. mitis and 10 strains of S. oralis), which were used for the cross-reactivity studies.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Laboratory Medicine, Nagasaki University Graduate School of Biomedical Sciences, 1-7-1 Sakamoto, Nagasaki City 852-8501, Japan. Phone: 81-95-849-7418. Fax: 81-95-849-7257. E-mail: kyana-ngs{at}umin.ac.jp Back

{triangledown} Published ahead of print on 7 May 2008. Back

{dagger} Supplemental material for this article may be found at http://jcm.asm.org/. Back


arrow
REFERENCES
 
    1
  1. Afessa, B., R. D. Hubmayr, E. A. Vetter, M. T. Keegan, K. I. Swanson, L. M. Baddour, F. R. Cockerill III, and S. G. Peters. 2006. Bronchoscopy in ventilator-associated pneumonia: agreement of calibrated loop and serial dilution. Am. J. Respir. Crit. Care Med. 172:1229-1232.
  2. 2
  3. Apfalter, P., B. Stoiser, W. Barousch, M. Nehr, L. Kramer, and H. Burgmann. 2005. Community-acquired bacteria frequency detected by means of quantitative polymerase chain reaction in nosocomial early-onset ventilator associated pneumonia. Crit. Care Med. 33:1492-1498.[CrossRef][Medline]
  4. 3
  5. Arbique, J. C., C. Poyart, P. Trieu-Cuot, G. Quesne, M. G. S. da Carvalho, A. G. Steigerwalt, R. E. Morey, D. Jackson, R. J. Davidson, and R. R. Facklam. 2004. Accuracy of phenotypic and genotypic testing for identification of Streptococcus pneumoniae and description of Streptococcus pseudopneumoniae sp. nov. J. Clin. Microbiol. 42:4686-4696.
  6. 4
  7. Baquero, F. 1995. Pneumococcal resistance to β-lactam antibiotics: a global geographic overview. Microb. Drug Resist. 1:115-120.[Medline]
  8. 5
  9. Bayram, A., E. Kocoglu, I. Balci, A. Filiz, and F. Eksi. 2006. Real-time polymerase chain reaction assay for detection of Streptococcus pneumoniae in sputum samples from patients with community-acquired pneumonia. J. Microb. Immunol. Infect. 39:452-457.
  10. 6
  11. Clancy, J., J. Petitpas, F. Dib-Haji, W. Yuan, M. Cronan, A. V. Kamath, J. Bergeron, and J. A. Retsema. 1996. Molecular cloning and functional analysis of a novel macrolide-resistance determinant, mefA, from Streptococcus pyogenes. Mol. Microbiol. 22:867-879.[CrossRef][Medline]
  12. 7
  13. Clinical and Laboratory Standards Institute. 2006. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically; approved standard, 7th ed. CLSI document M7-A7. Clinical and Laboratory Standards Institute, Wayne, PA.
  14. 8
  15. Clinical and Laboratory Standards Institute. 2006. Performance standards for antimicrobial susceptibility testing; 16th informational supplement. CLSI document M100-S16. Clinical and Laboratory Standards Institute, Wayne, PA.
  16. 9
  17. Delclaux, C., F. E. Roupie, Blot, L. Brochard, F. Lemaire, and C. Brun-Buisson. 1997. Lower respiratory tract colonization and infection during severe acute respiratory distress syndrome: incidence and diagnosis. Am. J. Respir. Crit. Care Med. 156:1092-1098.[Abstract/Free Full Text]
  18. 10
  19. Dowson, C. G., A. Hutchinson, J. A. Brannigan, R. C. George, D. Hansman, J. Linares, A. Tomasz, J. M. Smith, and B. G. Spratt. 1989. Horizontal transfer of penicillin-binding protein genes in penicillin-resistant clinical isolates of Streptococcus pneumoniae. Proc. Natl. Acad. Sci. USA 86:8842-8846.[Abstract/Free Full Text]
  20. 11
  21. Farrell, D. J., I. Morrissey, S. Bakker, L. Morris, S. Buckridge, and D. Felmingham. 2004. Molecular epidemiology of multiresistant Streptococcus pneumoniae with both erm(B)- and mef(A)-mediated macrolide resistance. J. Clin. Microbiol. 42:764-768.[Abstract/Free Full Text]
  22. 12
  23. Hakenbeck, R., T. Grebe, D. Zahner, and J. B. Stock. 1999. β-Lactam resistance in Streptococcus pneumoniae: penicillin-binding proteins and non-penicillin binding proteins. Mol. Microbiol. 33:673-678.[CrossRef][Medline]
  24. 13
  25. Ho, P. L., R. C. W. Wong, F. K. H. Chow, M. Y. M. Cheung, S. S. Y. Wong, W. C. Yam, and T. L. Que. 2004. Application of a multiplex pbp2b and pbp2x PCR for prediction of penicillin resistance in Streptococcus pneumoniae. J. Antimicrob. Chemother. 53:890-891.[Free Full Text]
  26. 14
  27. Jalal, H., S. Organji, J. Reynolds, D. Bennett, E. O'Mason, Jr., and M. R. Millar. 1997. Determination of penicillin susceptibility of Streptococcus pneumoniae using the polymerase chain reaction. Mol. Pathol. 50:45-50.[Abstract/Free Full Text]
  28. 15
  29. Kais, M., C. Spindler, M. Kain, A. Ortqvist, and C. G. Giske. 2006. Quantitative detection of Streptococcus pneumoniae, Haemophilus influenzae, and Moraxella catarrhalis in lower respiratory tract samples by real-time PCR. Diagn. Microbiol. Infect. Dis. 55:169-178.[CrossRef][Medline]
  30. 16
  31. Laible, G., B. G. Spratt, and R. Hakenbeck. 1991. Interspecies recombinational events during the evolution of altered PBP2X genes in penicillin-resistant clinical isolates of Streptococcus pneumoniae. Mol. Microbiol. 5:1993-2000.[Medline]
  32. 17
  33. Lentino, J. R., and D. A. Lucks. 1987. Nonvalue of sputum culture in the management of lower respiratory tract infections. J. Clin. Microbiol. 25:758-762.[Abstract/Free Full Text]
  34. 18
  35. Mandell, L. A., J. G. Bartlett, S. F. Dowell, T. M. File, Jr., D. M. Musher, and C. Whitney. 2003. Update of practice guidelines for the management of community-acquired pneumonia in immunocompetent adults. Clin. Infect. Dis. 27:1405-1433.
  36. 19
  37. Miller, D. L., and R. Jones. 1963. A study of techniques for the examination of sputum in a field survey of chronic bronchitis. Am. Rev. Respir. Dis. 88:473-483.[Medline]
  38. 20
  39. Morozumi, M., E. Nakayama, Y. S. Iwata, Aoki, K. Hasegawa, R. Kobayashi, N. Chiba, T. Tajima, and K. Ubukata. 2006. Simultaneous detection of pathogens in clinical samples from patients with community-acquired pneumonia by real-time PCR with pathogen-specific molecular beacon probes. J. Clin. Microbiol. 44:1440-1446.[Abstract/Free Full Text]
  40. 21
  41. Nagai, K., Y. Shibasaki, K. Hasegawa, T. A. Davis, M. R. Jacobs, K. Ubukata, and P. C. Appelbaum. 2001. Evaluation of PCR primers to screen for Streptococcus pneumoniae isolates and β-lactam resistance, and to detect common macrolide resistance determinants. J. Antimicrob. Chemother. 48:915-918.[Abstract/Free Full Text]
  42. 22
  43. Niederman, M. S., L. A. Mandell, A. Anzueto, J. B. Bass, W. A. Broughton, G. D. Campbell, N. Dean, T. File, M. J. Fine, P. A. Gross, F. Martinez, T. J. Marrie, J. F. Plouffe, J. Ramirez, G. A. Sarosi, A. Torres, R. Wilson, and V. L. Yu. 2001. Guidelines for the management of adults with community-acquired pneumonia. Am. J. Respir. Crit. Care Med. 163:1730-1754.[Free Full Text]
  44. 23
  45. Roberts, M. C., J. Sutcliffe, P. Courvalin, L. B. Jensen, J. Rood, and H. Seppala. 1999. Nomenclature for macrolide and macrolide-lincosamide-streptogramin B resistance determinants. Antimicrob. Agents Chemother. 43:2823-2830.[Free Full Text]
  46. 24
  47. Sahm, D. F., M. E. Jones, M. L. Hickey, D. R. Diakun, S. Y. Mani, and C. Thornsberry. 2000. Resistance surveillance of Streptococcus pneumoniae, Haemophilus influenzae, and Moraxella catarrhalis isolated in Asia and Europe, 1997-1998. J. Antimicrob. Chemother. 45:457-466.[Abstract/Free Full Text]
  48. 25
  49. Sanbongi, Y., T. Ida, M. Ishikawa, Y. Osaki, H. Kataoka, T. Suzuki, K. Kondo, F. Ohsawa, and M. Yonezawa. 2004. Complete sequences of six penicillin-binding protein genes from 40 Streptococcus pneumoniae clinical isolates collected in Japan. Antimicrob. Agents Chemother. 48:2244-2250.[Abstract/Free Full Text]
  50. 26
  51. Sheppard, C. L., T. G. Harrison, R. Morris, A. Hogan, and R. C. George. 2004. Autolysin-targeted LightCycler assay including internal process control for detection of Streptococcus pneumoniae DNA in clinical strains. J. Med. Microbiol. 53:189-195.[Abstract/Free Full Text]
  52. 27
  53. Skerrett, S. J. 1999. Diagnostic testing for community-acquired pneumonia. Clin. Chest Med. 20:531-548.[CrossRef][Medline]
  54. 28
  55. Smith, A. M., and K. P. Klugman. 1995. Alterations in penicillin-binding protein 2B from penicillin-resistant wild-type strains of Streptococcus pneumoniae. Antimicrob. Agents Chemother. 39:859-867.[Abstract]
  56. 29
  57. Smith, A. M., and K. P. Klugman. 1998. Alterations in PBP 1A essential for high-level penicillin resistance in Streptococcus pneumoniae. Antimicrob. Agents Chemother. 42:1329-1333.[Abstract/Free Full Text]
  58. 30
  59. Song, J. H., N. Y. Lee, S. Ichiyama, R. Yoshida, Y. Hirakata, W. Fu, A. Chongthaleong, N. Aswapokee, C. H. Chiu, M. K. Lalitha, K. Thomas, J. Perera, T. T. Yee, F. Jamal, U. C. Warsa, B. X. Vinh, M. R. Jacobs, P. C. Appelbaum, and C. H. Pai. 1999. Spread of drug resistant Streptococcus pneumoniae in Asian countries: Asian Network for Surveillance of Resistant Pathogens (ANSORP) study. Clin. Infect. Dis. 28:1206-1211.[Medline]
  60. 31
  61. Sutcliffe, J., T. Grebe, A. T. Kamradt, and L. Wondrack. 1996. Detection of erythromycin-resistant determinants by PCR. Antimicrob. Agents Chemother. 40:2562-2566.[Abstract]
  62. 32
  63. Tait-Kamradt, A., J. Clancy, M. Cronan, F. Dib-Hajj, L. Wondrack, W. Yuan, and J. Sutcliffe. 1997. mefE is necessary for the erythromycin-resistant M phenotype in Streptococcus pneumoniae. Antimicrob. Agents Chemother. 41:2251-2255.[Abstract]
  64. 33
  65. Tang, Y. W., H. Li, J. P. Griffin, D. W. Haas, and E. M. D'Agata. 2002. Rapidly increasing prevalence of penicillin-resistant Streptococcus pneumoniae in middle Tennessee: a 10-year clinical and molecular analysis. J. Clin. Microbiol. 40:395-399.[Abstract/Free Full Text]
  66. 34
  67. Ubukata, K., Y. Asahi, A. Yamane, and M. Konno. 1996. Combinational detection of autolysin and penicillin-binding protein 2B genes of Streptococcus pneumoniae by PCR. J. Clin. Microbiol. 34:592-596.[Abstract]
  68. 35
  69. Ubukata, K., T. Muraki, A. Igarashi, Y. Asahi, and M. Konno. 1997. Identification of penicillin and other beta-lactam resistance in Streptococcus pneumoniae by polymerase chain reaction. J. Infect. Chemother. 3:190-197.[CrossRef]
  70. 36
  71. Yang, S., S. Lin, A. Khalil, C. Gaydos, E. Nuemberger, G. Juan, J. Hardick, J. G. Bartlett, P. G. Auwaerter, and R. E. Rothman. 2005. Quantitative PCR assay using sputum samples for rapid diagnosis of pneumococcal pneumonia in adults emergency department patients. J. Clin. Microbiol. 43:3221-3226.[Abstract/Free Full Text]
  72. 37
  73. Whatmore, A. M., A. Efstratiou, A. P. Pickerill, K. Broughton, G. Woodard, D. Sturgeon, R. George, and C. G. Dowson. 2000. Genetic relationships between clinical isolates of Streptococcus pneumoniae, Streptococcus oralis, and Streptococcus mitis: characterization of "atypical" pneumococci and organisms allied to S. mitis harboring S. pneumoniae virulence factor-encoding genes. Infect. Immun. 68:1374-1382.[Abstract/Free Full Text]


Journal of Clinical Microbiology, July 2008, p. 2384-2388, Vol. 46, No. 7
0095-1137/08/$08.00+0     doi:10.1128/JCM.00051-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Lawrence, K. L., Kollef, M. H. (2009). Antimicrobial Stewardship in the Intensive Care Unit: Advances and Obstacles. Am. J. Respir. Crit. Care Med. 179: 434-438 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fukushima, K. Y.
Right arrow Articles by Kamihira, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fukushima, K. Y.
Right arrow Articles by Kamihira, S.