Previous Article | Next Article ![]()
Journal of Clinical Microbiology, July 2008, p. 2384-2388, Vol. 46, No. 7
0095-1137/08/$08.00+0 doi:10.1128/JCM.00051-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
,
Department of Laboratory Medicine,1 Second Department of Internal Medicine, Nagasaki University Graduate School of Biomedical Sciences, 1-7-1 Sakamoto, Nagasaki City 852-8501, Japan2
Received 10 January 2008/ Returned for modification 3 March 2008/ Accepted 29 April 2008
|
|
|---|
|
|
|---|
We used 200 clinical isolates of S. pneumoniae screened by optochin susceptibility (susceptible) and bile solubility (soluble) that were collected from April 2004 to March 2006 by a laboratory at the Nagasaki University Hospital. Strains were propagated on 5% sheep blood agar (Nissui Co., Ltd., Tokyo, Japan) at 37°C with 5% CO2. A mixture of 24 bacterial species from the American Type Culture Collection (ATCC; see Table S1 in the supplemental material) were selected from species commonly isolated from respiratory tract and from species that are genetically related to S. pneumoniae (3). In addition, 17 clinical strains of Streptococcus mitis and 12 clinical strains of Streptococcus oralis, which had been isolated from respiratory tract samples, were collected for cross-reactivity studies.
The MICs were determined by using broth microdilution techniques as described by the Clinical and Laboratory Standards Institute (CLSI) guidelines (7, 8). S. pneumoniae ATCC 49619 was used for quality control.
A total of 200 purulent sputum samples, which were collected from April 2004 to March 2005 and from June 2007 to August 2007 by a laboratory at the Nagasaki University Hospital, were used. Only good-quality sputum samples (P2 and P3 according to the classification of Miller and Jones (19) were used. Sputum samples were diluted 1:100 and 1:10,000 with 0.45% sodium chloride and treated with Sputazyme solution (Kyokuto Pharmaceutical Industries Co., Ltd., Tokyo, Japan). The diluted samples were spread on 5% sheep blood agar plates with a DS500 spiral plater (InterScience, Inc., Markham, Ontario, Canada) and then incubated at 37°C in 5% CO2. Optochin sensitivity and bile solubility were used to identify S. pneumoniae. Nucleic acids were isolated from clinical strains and sputum samples by using a QIAamp DNA blood minikit (Qiagen, Hilden, Germany).
The lytA, pbp1a, pbp2b, pbp2x, ermB, and mefA genes were amplified by PCR. Primers LytA-F and LytA-R and probes LytA-DCR and LytA-ACR were designed to target a 173-bp fragment of the single copy autolysin (lytA) gene of S. pneumoniae and were gleaned from published sequence (26). The primers for amplification of the pbp1a, pbp2b, and pbp2x genes were newly designed as follows: pbp1a (353 bp), 5'-1709AGTATATCAAGAACACTGGCTACG1732 and 5'-2061GCTTGGAGTGGTTGAGCTA2079-3'; pbp2b (442 bp), 5'-1291AAATTGGCATATGGATCTTTTC1312-3' and 5'-1732TATTCATCTCTGTCGGTTGC1751-3'; and pbp2x (339 bp), 5'-990AAGTAACTATGAACCAGGATCAG1012-3' and 5'-1388CGAAGCATTTGTGTTTGTGT1407-3'. The resistance pbp1a primers were designed to target four amino acid substitutions (Thr-574
Asn, Ser-575
Thr, Gln-576
Gly, and Phe-577
Thr) that are common to all penicillin G (PCG)-intermediate and -resistant isolates (29). The resistance pbp2x primers were designed to target amino acid substitutions in the 337STMK motif, and the resistance pbp2b primers were designed to target amino acid substitutions close to the 448SSN motif (25, 28). The primers for amplification of the ermB (224-bp) and mefA (294-bp) genes were gleaned from a published sequence (21). All of the primers used for RQ-mPCR had almost identical annealing temperatures (range, from 59.0 to 62.5°C), which reduces the occurrence of unwanted bands originating from nonspecific amplification. The PCR product amplified from S. pneumoniae ATCC 49619 using the LytA-F and LytA-R primer set was ligated into the pTAC-1 plasmid vector (BioDynamics, Tokyo, Japan) by using the TA PCR cloning technique. Plasmid standards containing 2.9 x 106 to 2.9 x 100 copies/µl were prepared by diluting the plasmid extracts in water. The standard curve was generated and exported by using LightCycler software (v3.5). PCR was performed on a LightCycler instrument. The final 20-µl single-tube reaction mixture contained 2x LightCycler FastStart DNA Master HybProbe (Roche Diagnostics, Basal, Switzerland), 5 mM MgCl2, 0.5 µM concentrations of each primer (LytA-F, LytA-R, pbp1a-F, pbp1a-R, pbp2b-F, pbp2b-R, pbp2x-F, pbp2x-R, mef-F, mef-R, erm-F, and erm-R), 0.2 µM concentrations of each hybridization probe (LytA-DCR and LytA-ACR), and 2 µl of DNA template. The cycling conditions were as follows: 95°C for 10 min, followed by 40 cycles of 95°C for 5 s, 60°C for 10 s, and 72°C for 15 s. All runs included a negative control of water and a calibrator/positive control of 2.9 x 106 copies of the plasmid/µl used for the standard curve. The data were analyzed by using LightCycler Software (v3.5) in the F2/F1 mode with a fit point calculation method. After amplification, 10 µl of the PCR product was separated by electrophoresis on a 3% agarose gel (Cambrex BioScience/Rockland, Inc., Rockland, ME) for 30 min at 100 V. The positions of DNA fragments are shown in Fig. 1A, lane M (100-bp ladder; Amersham Biosciences). Figure 1B shows the presence of the amplified products after agarose gel electrophoresis when DNA was extracted from representative PCG- and erythromycin (EM)-resistant S. pneumoniae strains (lane 1, ATCC 49619 (MICs of PCG = 0.25 µg/ml and EM < 0.5 µg/ml); lane 2, clinical strain 4808/S (MICs of PCG < 0.015 µg/ml and EM < 0.5 µg/ml); lane 3, clinical strain 1512/F (MICs of PCG = 0.03 µg/ml and EM = 2 µg/ml); lane 4, clinical strain 1565/F (MICs of PCG = 0.03 µg/ml and EM = 32 µg/ml); lane 5, clinical strain 8315/F (MICs of PCG = 0.12 µg/ml and EM = 0.5 µg/ml); lane 6, clinical strain 4827/F (MIC of PCG = 0.12 µg/ml and EM = 32 µg/ml); lane 7, clinical strain 8605/Z (MICs of PCG = 8 µg/ml and EM < 0.5 µg/ml); lane 8, clinical strain 8729/Z (MICs of PCG = 4 µg/ml and EM = 8 µg/ml); lane 9, clinical strain 1824/F (MICs of PCG = 2 µg/ml and EM = 16 µg/ml); lane M, 100-bp ladder).
![]() View larger version (50K): [in a new window] |
FIG. 1. New multiplex PCR assay for simultaneous detection of lytA, penicillin resistance genes (altered pbp1a, pbp2x, and pbp2b), and macrolide resistance genes [erm(B) and mef(A)]. (A) Comparison of single-target versus multiplex PCRs using "resistant" control strain 1824/F. Lane M, 100-bp ladder (Amersham Biosciences). (B) Agarose gel electrophoresis of PCR products amplified with RQ-mPCR using control strains. Lane 1, ATCC 49619 (MICs of 0.25 µg/ml for PCG and <0.5 µg/ml for EM); lane 2, clinical strain 4808/S (MICs of <0.015 µg/ml for PCG and <0.5 µg/ml for EM); lane 3, clinical strain 1512/F (MICs of 0.03 µg/ml for PCG and 2 µg/ml for EM); lane 4, clinical strain 1565/F (MICs of 0.03 µg/ml for PCG and 32 µg/ml for EM); lane 5, clinical strain 8315/F (MICs of 0.12 µg/ml for PCG and 0.5 µg/ml for EM); lane 6, clinical strain 4827/F (MICs of 0.12 µg/ml for PCG and 32 µg/ml for EM); lane 7, clinical strain 8605/Z (MICs of 8 µg/ml for PCG and <0.5 µg/ml for EM); lane 8, clinical strain 8729/Z (MICs of 4 µg/ml for PCG and 8 µg/ml for EM); lane 9, clinical strain 1824/F (MICs of 2 µg/ml for PCG and 16 µg/ml for EM); lane M, 100-bp ladder (Amersham Biosciences).
|
10 ng/µl) from 47 nonpneumococcal organisms (including 17 clinical isolates of S. mitis and 12 clinical isolates of S. oralis) cross-react with the primer-probe set, showing that the lytA primer-probe set was 100% specific for detecting S. pneumoniae strains. We used S. pneumoniae ATCC 49619 (positive for lytA and pbp1a), S. pneumoniae clinical strain 4808/S (positive for lytA only) and S. pneumoniae clinical strain 1824/F [positive for lytA, erm(B), mef(A), pbp1a, pbp2x, and pbp2b] to examine the analytical sensitivity of S. pneumoniae quantification by RQ-mPCR (see Fig. S1A in the supplemental material). The detection limit of lytA quantification was 20 copies/assay (10 copies/µl), which corresponds to 5 x 102 CFU/ml. To verify the analytical sensitivities of drug resistance genes in RQ-mPCR, we used S. pneumoniae clinical strain 1824/F and assessed the appearance of PCR products by gel electrophoresis (see Fig. S1B in the supplemental material). The detection limits of the five drug-resistant genes were between 5.8 x 101 and 5.8 x 102 copies/assay (between 103 and 104 CFU/ml). To validate the RQ-mPCR technique, all of the 200 S. pneumoniae strains that were tested by RQ-mPCR were also screened for the presence of individual resistance genes by a single PCR using the PCR conditions described above. The results of the two methods were in full agreement (data not shown), suggesting that the multiplex PCR primer sets are reliable. The RQ-mPCR results of 200 S. pneumoniae strains and the MIC distribution of PCG and EM are shown in Tables 1 and 2. All of the 200 strains were positive for the lytA gene. The multiplex PCR correctly identified penicillin susceptibility (MIC
0.06 µg/ml) or nonsusceptibility (MIC
0.12 µg/ml) in 189 (94.5%) of 200 isolates evaluated. The sensitivity, specificity, positive predictive values, and negative predictive values of our assay were 98.1% (103/105), 90.5% (86/95), 91.9% (103/112), and 97.7% (86/88), respectively. Our assay also correctly identified EM susceptibility (MIC
0.5 µg/ml) or resistant (MIC
1 µg/ml) in 200 (100%) out of 200 isolates evaluated. All of these isolates yielded 100% sensitivity, 100% specificity, 100% positive predictive values, and 100% negative predictive values. |
View this table: [in a new window] |
TABLE 1. RQ-mPCR results and PCG MICs in 200 pneumococcal isolatesa
|
|
View this table: [in a new window] |
TABLE 2. RQ-mPCR results and EM MICs in 200 pneumococcal isolatesa
|
The penicillin- and macrolide-resistant genes detected by RQ-mPCR in purulent sputum samples are shown in Table 3. We compared these results to those in isolated S. pneumoniae from the same sputum samples. Of 56 pneumococcal culture-positive sputum samples, all were positive for lytA gene, and for 51 samples the detected genes were in complete agreement with the isolated S. pneumoniae. For the remaining five samples, the genes were not in complete agreement with the isolated S. pneumoniae: two samples were false positives for erm(B); one sample was false positive for mef(A), pbp1a, pbp2x, and pbp2b; one sample was false positive for pbp2x and pbp2b; and one sample was false positive for mef(A) and false negative for pbp1a. The sensitivities and specificities of this assay for detecting genes directly from sputum samples relative to isolated S. pneumoniae were 100 and 93.9% for erm(B), 100 and 94.8% for mef(A), 94.4 and 97.5% for pbp1a, 100 and 94.1% for pbp2x, and 100 and 95.6% for pbp2b, respectively. With regard to the 144 pneumococcal culture-negative sputum samples, the detection rates of drug resistant genes were 0% for pbp1a, 2.7% (4/144) for pbp2x, 1.4% (2/144) for pbp2b, 20.8% (30/144) for erm(B), and 11.1% (16/144) for mef(A).
|
View this table: [in a new window] |
TABLE 3. Comparison of RQ-mPCR results between in pneumococcal positive sputum samples and in S. pneumoniae isolates
|
A discrepancy in RQ-mPCR specificity for samples 102/5F01 [false positive for mef(A)], 107/5F23 (false positive for pbp2x and pbp2b), 113/5F28 [false positive for mef(A), pbp1a, pbp2x, and pbp2b], and 101/6S11 and 101/6D13 [false positive for erm(B)] was confirmed by single PCR. This discrepancy indicates the presence of similar resistance genes in other microorganisms in the sputum samples. Avoiding these problems with cross-reactivity is difficult because the mosaic genes that encode altered, low-affinity pbp genes are considered products of recombination events involving horizontal transfer from closely related species (10, 16) and also because erm(B) and mef(A) macrolide-resistant genes in S. pneumoniae are highly homologous to genes in other Streptococcus-related species (6). In sample 102/5F01, pbp1a was detected by a single PCR, suggesting that the discrepancy in sensitivity (false negative) was due to the presence of PCR inhibitors or to a decline of sensitivity in this sputum sample. Although the sensitivity and specificity rates of our assay for sputum samples were in general satisfactory, further investigations are needed to remove PCR inhibitors from samples and to increase the sensitivity of the assay. Although our RQ-mPCR assay showed high correlation between the conventional culture counts and the level of lytA gene expression, further data from patients with pneumonia are needed to evaluate and interpret the results of our assay.
In summary, the RQ-mPCR method developed here had high sensitivity and specificity for pneumococci and could detect drug resistance in both clinical S. pneumoniae strains and sputum samples. Furthermore, the results can be obtained directly from clinical samples within 3 h (2 h for DNA extraction and preparation of PCR mixture and 1 h for PCR assay and electrophoresis), and this assay requires only a single tube. This method may be helpful for the rapid screening of resistance in pneumococcal isolates and should allow the administration of earlier, more focused and effective treatment of drug-resistant S. pneumoniae.
Published ahead of print on 7 May 2008. ![]()
Supplemental material for this article may be found at http://jcm.asm.org/. ![]()
|
|
|---|
ares, A. Tomasz, J. M. Smith, and B. G. Spratt. 1989. Horizontal transfer of penicillin-binding protein genes in penicillin-resistant clinical isolates of Streptococcus pneumoniae. Proc. Natl. Acad. Sci. USA 86:8842-8846.
tqvist, and C. G. Giske. 2006. Quantitative detection of Streptococcus pneumoniae, Haemophilus influenzae, and Moraxella catarrhalis in lower respiratory tract samples by real-time PCR. Diagn. Microbiol. Infect. Dis. 55:169-178.[CrossRef][Medline]This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»