Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Lockhart, S. R. Articles by Diekema, D. J. Search for Related Content PubMed PubMed Citation Articles by Lockhart, S. R. Articles by Diekema, D. J.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, January 2009, p. 242-244, Vol. 47, No. 1
0095-1137/09/$08.00+0     doi:10.1128/JCM.01889-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Identification and Susceptibility Profile of Candida fermentati from a Worldwide Collection of Candida guilliermondii Clinical Isolates

Shawn R. Lockhart,^* Shawn A. Messer, Michael A. Pfaller, and Daniel J. Diekema

University of Iowa, Carver College of Medicine, Iowa City, Iowa 52242

Received 30 September 2008/ Returned for modification 3 November 2008/ Accepted 17 November 2008

Top ABSTRACT TEXT REFERENCES

 
Candida fermentati isolates make up a small percentage of the clinical isolates of the Candida guilliermondii complex and have a global distribution pattern. With the exception that the MICs of micafungin were significantly lower, the calculated average MICs for C. fermentati were not significantly different from those for C. guilliermondii.

Top ABSTRACT TEXT REFERENCES

 
Candida species are now the fourth leading cause of nosocomial bloodstream infections in U.S. hospitals and have one of the highest mortality rates among nosocomial pathogens (20). Candida guilliermondii makes up only a small proportion of these bloodstream infection isolates, 1 to 3%, depending upon the geographic region (14), but what makes these isolates of particular clinical importance is the decreased susceptibility of this species to fluconazole and the relatively high MICs of this species to the echinocandins (4, 10, 12, 13, 14). There are also a number of recent reports of high infection rates in pediatric unit patients, a particularly vulnerable population (8, 11).

Using the strength of molecular identification, there has been an increased interest in identifying cryptic species within larger species complexes such as Candida orthopsilosis, Candida metapsilosis, and Lodderomyces elongisporus in the Candida parapsilosis complex (6, 7, 18) and Candida nivariensis and Candida bracarensis, members of the Candida glabrata clade (2, 3). With the parental species of many of these complexes carrying a decreased susceptibility to antifungal drugs, it is important to identify these cryptic species to determine whether they carry an increased burden of antifungal resistance (2, 3, 6, 7). In that light, we screened a large global collection of C. guilliermondii isolates for the presence of Candida fermentati, a closely related species for which there is almost no clinical information (1, 5).

All of the yeast isolates submitted to the University of Iowa as part of the ARTEMIS Antifungal Surveillance Program were identified with the Vitek yeast identification system (BioMérieux, Durham, NC). Candida guilliermondii was morphologically distinguished from C. famata by detection of pseudohyphae on corn meal agar following 10 days of incubation at 25°C. All isolates identified as C. guilliermondii were subject to PCR with the primers RIBO-F (5'ACAGTTGGTCGAGGTGGTC3') and RIBO-R (5'CCTGGGTTCCCAAGTAGTCA3'). The identification scheme used to differentiate between C. guilliermondii and C. fermentati was described by Lan and Xu (5). Briefly, a single fragment of the riboflavin synthetase gene (RIBO) was amplified. In two separate reactions, the fragment was individually cleaved with the restriction enzyme HgaI or HincII. The presence of cleavage, as well as the size of the cleavage fragments, was used to differentiate between C. guilliermondii and C. fermentati. Only isolates that had one of the two outlined cleavage patterns were included in the analysis. P values were determined with the Student t test.

Of the isolates banked between 2001 and 2007, 149 were identified as C. guilliermondii complex isolates and 13 (8.7%) of those isolates were further identified as C. fermentati. The C. fermentati isolates originated from North America, South America, Europe, Asia, and Australia (Table 1). Previous C. fermentati isolates have been reported from India, the United Kingdom, Japan, and Brazil (8, 17, 19). There have been no clinical or surveillance reports of C. fermentati and very few of C. guilliermondii isolates from Africa, but this may be due to the paucity of information from that region. Eight of the 11 isolates for which epidemiological data were available were bloodstream isolates, similar to the 78% of C. guilliermondii isolates that were from bloodstream infections. While 80% of the patients with a C. fermentati infection were 40 years old, only 38% of the C. guilliermondii isolates came from patients who were 40 years old. Only 10% of the C. fermentati isolates were from a pediatric population, while 29% of the C. guilliermondii isolates were from pediatric patients.

View this table: [in this window] [in a new window]

TABLE 1. Demographic and antifungal susceptibility data for the C. fermentati isolates in this study

Antifungal susceptibility testing was performed on all of the isolates by broth microdilution for fluconazole, voriconazole, posaconazole, caspofungin, anidulafungin, and micafungin and by Etest for amphotericin B as outlined in Clinical and Laboratory Standards Institute document M27-A2 and as previously described (9, 15) All MICs were determined visually. Echinocandin MICs were determined at 24 h, while azole and amphotericin B values were determined at 48 h. None of the 13 C. fermentati isolates were resistant to fluconazole, but 38% of them were susceptible dose dependent (SDD). The geometric mean MIC of fluconazole was higher than the geometric mean for the 136 C. guilliermondii isolates included in this study (Table 2), but the difference did not reach statistical significance. In a large global study of C. guilliermondii isolates, Pfaller and colleagues (14) found that 14% were SDD and 11% were fully resistant (although C. fermentati isolates were not distinguished in this study), and in a recent report from India of five isolates of C. fermentati from the oral cavities of human immunodeficiency virus patients, the reported geometric mean MIC of these isolates for fluconazole was 8 µg/ml, with one SDD isolate and one fully resistant isolate (19). There was one C. fermentati isolate SDD to voriconazole. Breakpoints for Candida spp. to posaconazole have not yet been established, but the differences between C. fermentati and C. guilliermondii were not statistically significant.

View this table: [in this window] [in a new window]

TABLE 2. Geometric mean MICs and statistical significance of differences between C. guilliermondii and C. fermentati MICs

According to the recently recommended breakpoint value of 2 µg/ml for the echinocandins (16), only a single C. fermentati isolate with an anidulafungin MIC of 4 µg/ml fell outside of the susceptible range for any of the echinocandins tested. By comparison, 4% of the C. guilliermondii isolates were nonsusceptible to caspofungin, 11.8% were nonsusceptible to anidulafungin, and none were nonsusceptible to micafungin. It is interesting that the geometric mean MIC for C. fermentati and micafungin was statistically significantly lower than the geometric mean MIC for C. guilliermondii. Although the geometric mean MIC of the C. fermentati isolates against amphotericin B was higher than that for the C. guilliermondii isolates, all of the values fell below 0.5 µg/ml.

In conclusion, C. fermentati isolates are not significantly different enough from C. guilliermondii isolates in terms of antifungal susceptibility to warrant routine identification in the clinical microbiology laboratory. However, given the high average MICs of fluconazole reported here and elsewhere (19) and the ease with which C. fermentati and C. guilliermondii can be distinguished, this is a species for which further surveillance is warranted.

 
The findings and conclusions of this article are ours and do not necessarily represent the views of the CDC.

 
* Corresponding author. Present address: Mycotic Diseases Branch, Centers for Disease Control and Prevention, 1600 Clifton Rd., Mailstop G-11, Atlanta, GA 30333. Phone: (404) 639-2569. Fax: (404) 639-3546. E-mail: gyi2{at}cdc.gov

Published ahead of print on 26 November 2008.

Top ABSTRACT TEXT REFERENCES

 

1
1. Bai, F.-Y. 1996. Separation of Candida fermentati comb. nov. from Candida guilliermondii by DNA base composition and electrophoretic karyotyping. Syst. Appl. Microbiol. 19:178-181.
2
2. Bishop, J. A., N. Chase, S. S. Magill, C. P. Kurtzman, M. J. Fiandaca, and W. G. Merz. 2008. Candida bracarensis detected among isolates of Candida glabrata by peptide nucleic acid fluorescence in situ hybridization: susceptibility data and documentation of presumed infection. J. Clin. Microbiol. 46:443-446.[Abstract/Free Full Text]
3
3. Borman, A. M., R. Petch, C. J. Linton, M. D. Palmer, P. D. Bridge, and E. M. Johnson. 2008. Candida nivariensis, an emerging pathogenic fungus with multidrug resistance to antifungal agents. J. Clin. Microbiol. 46:933-938.[Abstract/Free Full Text]
4
4. Cuenca-Estrella, M., L. Rodero, G. García-Effrón, and J. L. Rodriguez-Tudela. 2002. Antifungal susceptibilities of Candida spp. isolated from blood in Spain and Argentina, 1996-1999. J. Antimicrob. Chemother. 49:981-987.[Abstract/Free Full Text]
5
5. Lan, L., and J. Xu. 2006. Multiple gene genealogical analyses suggest divergence and recent clonal dispersal in the opportunistic human pathogen Candida guilliermondii. Microbiology 152:1539-1549.[Abstract/Free Full Text]
6
6. Lockhart, S. R., S. A. Messer, M. A. Pfaller, and D. J. Diekema. 2008. Geographic distribution and antifungal susceptibility of the newly described species Candida orthopsilosis and Candida metapsilosis in comparison to the closely related species Candida parapsilosis. J. Clin. Microbiol. 46:2659-2664.[Abstract/Free Full Text]
7
7. Lockhart, S. R., S. A. Messer, M. A. Pfaller, and D. J. Diekema. 2008. Lodderomyces elongisporus masquerading as Candida parapsilosis as a cause of bloodstream infections. J. Clin. Microbiol. 46:374-376.[Abstract/Free Full Text]
8
8. Medeiros, E. A., T. J. Lott, A. L. Colombo, P. Godoy, A. P. Coutinho, M. S. Braga, M. Nucci, and M. E. Brandt. 2007. Evidence for a pseudo-outbreak of Candida guilliermondii fungemia in a university hospital in Brazil. J. Clin. Microbiol. 45:942-947.[Abstract/Free Full Text]
9
9. National Committee for Clinical Laboratory Standards. 2002. Reference method for broth microdilution antifungal susceptibility testing of yeast, 2nd ed. Approved standard M27-A2. National Committee for Clinical Laboratory Standards, Wayne, PA.
10
10. Ostrosky-Zeichner, L., J. H. Rex, P. G. Pappas, R. J. Hamill, R. A. Larsen, H. W. Horowitz, W. G. Powderly, N. Hyslop, C. A. Kauffman, J. Cleary, J. E. Mangino, and J. Lee. 2003. Antifungal susceptibility survey of 2,000 bloodstream Candida isolates in the United States. Antimicrob. Agents Chemother. 47:3149-3154.[Abstract/Free Full Text]
11
11. Pemán, J., M. Bosch, E. Cantón, A. Viudes, I. Jarque, M. Gómez-García, J. M. García-Martínez, and M. Gobernado. 2008. Fungemia due to Candida guilliermondii in a pediatric and adult population during a 12-year period. Diagn. Microbiol. Infect. Dis. 60:109-112.[Medline]
12
12. Pfaller, M. A., L. Boyken, R. J. Hollis, J. Kroeger, S. A. Messer, S. Tendolkar, and D. J. Diekema. 2008. In vitro susceptibility of invasive isolates of Candida spp. to anidulafungin, caspofungin, and micafungin: six years of global surveillance. J. Clin. Microbiol. 46:150-156.[Abstract/Free Full Text]
13
13. Pfaller, M. A., L. Boyken, R. J. Hollis, S. A. Messer, S. Tendolkar, and D. J. Diekema. 2006. In vitro susceptibilities of Candida spp. to caspofungin: four years of global surveillance. J. Clin. Microbiol. 44:760-763.[Abstract/Free Full Text]
14
14. Pfaller, M. A., D. J. Diekema, M. Mendez, C. Kibbler, P. Erzsebet, S. C. Chang, D. L. Gibbs, and V. A. Newell. 2006. Candida guilliermondii, an opportunistic fungal pathogen with decreased susceptibility to fluconazole: geographic and temporal trends from the ARTEMIS DISK antifungal surveillance program. J. Clin. Microbiol. 44:3551-3556.[Abstract/Free Full Text]
15
15. Pfaller, M. A., D. J. Diekema, S. A. Messer, L. Boyken, and R. J. Hollis. 2003. Activity of fluconazole and voriconazole determined by broth microdilution, disk diffusion, and Etest methods against 1,586 recent clinical isolates of Candida species: report from the ARTEMIS Global Antifungal Susceptibility Program, 2001. J. Clin. Microbiol. 41:1440-1446.[Abstract/Free Full Text]
16
16. Pfaller, M. A., D. J. Diekema, L. Ostrosky-Zeichner, J. H. Rex, B. D. Alexander, D. Andes, S. D. Brown, V. Chaturvedi, M. A. Ghannoum, C. C. Knapp, D. J. Sheehan, and T. J. Walsh. 2008. Correlation of MIC with outcome for Candida species tested against caspofungin, anidulafungin, and micafungin: analysis and proposal for interpretive MIC breakpoints. J. Clin. Microbiol. 46:2620-2629.[Abstract/Free Full Text]
17
17. San Millán, R. M., L. C. Wu, I. F. Salkin, and P. F. Lehmann. 1997. Clinical isolates of Candida guilliermondii include Candida fermentati. Int. J. Syst. Bacteriol. 47:385-393.[Abstract/Free Full Text]
18
18. Tavanti, A., A. D. Davidson, N. A. R. Gow, M. C. J. Maiden, and F. C. Odds. 2005. Candida orthopsilosis and Candida metapsilosis spp. nov. to replace Candida parapsilosis groups II and III. J. Clin. Microbiol. 43:284-292.[Abstract/Free Full Text]
19
19. Umamaheswari, K., and T. Menon. 2008. Candida fermentati from HIV patients in Chennai, South India. Int. J. Infect. Dis. 12:e153-e154.[Medline]
20
20. Wisplinghoff, H., T. Bischoff, S. M. Tallent, H. Seifert, R. P. Wenzel, and M. B. Edmond. 2004. Nosocomial bloodstream infections in US hospitals: analysis of 24,179 cases from a prospective nationwide surveillance study. Clin. Infect. Dis. 39:309-317.[CrossRef][Medline]

---

Journal of Clinical Microbiology, January 2009, p. 242-244, Vol. 47, No. 1
0095-1137/09/$08.00+0     doi:10.1128/JCM.01889-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Lockhart, S. R. Articles by Diekema, D. J. Search for Related Content PubMed PubMed Citation Articles by Lockhart, S. R. Articles by Diekema, D. J.