Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by da Gloria Carvalho, M. Search for Related Content PubMed PubMed Citation Articles by da Gloria Carvalho, M.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, March 2009, p. 554-559, Vol. 47, No. 3
0095-1137/09/$08.00+0     doi:10.1128/JCM.01919-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

PCR-Based Quantitation and Clonal Diversity of the Current Prevalent Invasive Serogroup 6 Pneumococcal Serotype, 6C, in the United States in 1999 and 2006 to 2007

Maria da Gloria Carvalho,¹ Fabiana C. Pimenta,¹ Robert E. Gertz Jr.,¹ Hari Har Joshi,¹ Alma A. Trujillo,¹ Logan E. Keys,¹ Joy Findley,¹ Iaci S. Moura,¹ In H. Park,² Susan K. Hollingshead,³ Tamara Pilishvili,¹ Cynthia G. Whitney,¹ Moon H. Nahm,^2,3 Bernard W. Beall,^1* for the Active Bacterial Core Surveillance Team

Respiratory Diseases Branch, Centers for Disease Control & Prevention, Atlanta, Georgia 30333,¹ Department of Pathology,² Department of Microbiology, University of Alabama at Birmingham, Birmingham, Alabama 35294³

Received 3 October 2008/ Returned for modification 25 November 2008/ Accepted 23 December 2008

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Following introduction of the 7-valent pneumococcal conjugate vaccine to the United States, rates of invasive pneumococcal disease (IPD) caused by serotype 6A declined among all age groups, while rates of IPD caused by newly identified serotype 6C increased slightly among persons 5 years of age and older. Conventionally serotyped 6A isolates (CS6As) from active population-based surveillance during 1999 and 2006 to 2007 were classified as serotypes 6A and 6C by an expedient and highly accurate serotype 6C-specific PCR assay developed during this study. PCR testing of 636 year 1999, 2006, and 2007 CS6As revealed 6C proportions of 35/214 (16.4%), 141/218 (64.7%), and 141/204 (69.1%), respectively. These results agreed with those from a previously devised monoclonal antibody-based serotyping system (346 CS6As compared). Type 6C IPD incidence significantly increased during 2006 and 2007 compared to during 1999 (0.57 to 0.58 cases per 100,000 and 0.22 cases per 100,000, respectively; 164% increase from 1999 to 2007 [95% confidence interval, 87 to 270%]), while rates of IPD due to types 6A and 6B markedly decreased. In 2007, 31.2% of 6C isolates were not susceptible to penicillin. Serotype 6C is now the predominant serotype associated with serogroup 6 IPD in the United States and is often penicillin nonsusceptible. We performed multilocus sequence typing (MLST) on a limited sampling of 6C isolates with different antimicrobial susceptibility profiles. MLST of 42 6C isolates revealed 12 genotypes distributed among six distinct genetic groups. Fifteen 6C isolates shared one of four different MLST types with 6C-negative CS6As. MLST results suggest 6C strains arose from independent recombination events involving only serotype 6A and 6C parental strains.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
A new pneumococcal serotype within serogroup 6, 6C, was recently discovered during the development of a monoclonal antibody (MAb)-based typing scheme (7, 14), when a subset of conventionally serotyped 6A isolates (CS6As) did not bind to one of the two 6A-specific MAbs used. Subsequent analysis of this CS6A subset revealed a different capsular structure, which was designated 6C (14). The serotype 6C capsular biosynthetic locus (cps) appears to be derived from replacement of the wciN gene at the 6A cps locus with a divergent 6C-specific counterpart that encodes a different glycosyl transferase, resulting in a sugar substitution in the polysaccharide repeating unit (13).

The MAb typing system was used to resolve serotype 6C isolates among CS6As recovered during the pre-pneumococcal 7-valent conjugate vaccine (PCV7) year 1999 and post-PCV7 years 2003 to 2006 from areas under continuous surveillance in Active Bacterial Core surveillance (ABCs) in the United States (10). This investigation revealed a marked decrease in the rate of serotype 6A invasive pneumococcal disease (IPD) in the post-PCV7 period that was apparently due to cross-protection mediated by the serotype 6B component included in PCV7. The investigation also revealed a small, yet significant, increase in the rate of serotype 6C IPD. Here, we describe an expedient PCR assay for resolution of serotype 6C and true serotype 6A from CS6As. We extend our recent observations (10) through testing all available CS6As recovered from expanded ABCs areas during 1999, 2006, and 2007. Our results show that the proportion of type 6C to true 6A IPD isolates continued to increase during 2006 and 2007. The incidence of IPD caused by serotype 6C remained stable during 2006 and 2007, while the incidence of serotype 6A and 6B IPD continued to decline. We also show that serotype 6C is genetically diverse, with four of six distinct clonal backgrounds shared with recently recovered serotype 6A strains.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
CS6As and conventionally serotyped 6B isolates. Cases of IPD were identified through the Centers for Disease Control and Prevention's (CDC's) ABCs system and were defined as being the isolation of pneumococci from normally sterile sites in residents of surveillance areas (http://www.cdc.gov/ncidod/dbmd/abcs/index.htm). The population under surveillance during 1999 increased considerably from the previous report (12), with approximately 18.6 million persons (compared to almost 16 million during 1999), including residents of California (San Francisco County), Connecticut, Georgia (20 counties in the Atlanta area), Maryland (six counties in the Baltimore area), Minnesota (seven counties in the Twin Cities area), New York (seven counties in the Rochester area and eight in the Albany area), Oregon (three counties in the Portland area), and Tennessee (five urban counties). Populations of New Mexico and additional counties in California, Minnesota, and Tennessee were added during subsequent years such that the total population under surveillance during 2006 and 2007 was approximately 28.2 million according to 2006 postcensus population estimates (and therefore increased by more than 10 million individuals compared to the previous report [12]). All isolates described in this study were conventionally serotyped using latex agglutination and the quellung reaction. Thus, all isolates within serogroup 6 in this study were identified either as serotype 6B isolates or as CS6As. All isolates referred to as 6A or 6C in this report were determined as being 6C or 6C negative using the 6C-specific PCR assay described immediately below. The majority of the 1999 and 2006 CS6As (346 of 432) isolates were also tested using the MAb assay. All year 2007 CS6As were deduced as 6A or 6C solely by use of the 6C-specific PCR assay described below.

Serotype 6C determination. Crude DNA template from CS6As was subjected to a multiplex PCR containing primer pairs specific for cpsA (160 bp) and serogroup 6 (250 bp), as previously described (11). A third primer pair in the multiplex reaction contained the serotype 6C-specific primers 6C-fwd (CATTTTAGTGAAGTTGGCGGTGGAGTT) and 6C-rev (AGCTTCGAAGCCCATACTCTTCAATTA) for the amplification of a 727-bp wciN_6C gene fragment. Crude template preparation and specific reaction conditions are posted at http://www.cdc.gov/ncidod/biotech/strep/pcr.htm. PCR products were resolved on 2.0% NuSieve agarose containing 0.5 µg/ml ethidium bromide (Fig. 1).

View larger version (45K): [in this window] [in a new window]

FIG. 1. Serotype 6C PCR assay results, showing 15 serotype 6C-positive samples and one serogroup 6-positive sample that is 6C negative.

MLST. Multilocus sequence typing (MLST) was performed as described previously (5), with modifications (10), on 42 isolates recovered from 1999 to 2007 that were PCR positive for the wciN_6C gene. Thirty-seven of the 42 were also independently tested positively by the previously published MAb assay (14). At least one member of each clonal complex described in this study was verified as serotype 6C by both assays. We evaluated a sample of 6C isolates representing different susceptibility patterns for penicillin, erythromycin, and several other antibiotics using 2007 CSLI standards (3). We also performed MLST on 41 serotype 6A (determined through quellung and 6C-specific PCR tests) isolates recovered from 1999 to 2007 that represented all common susceptibility patterns and pulsed-field gel electrophoresis profiles found within invasive CS6As recovered in the United States (1, 6).

Susceptibility testing. Susceptibility testing was performed as previously described (9) using broth dilution and year 2007 Clinical and Laboratory Standards Institute cutoffs (3). Penicillin susceptibility was defined as a MIC of 0.6 µg/ml. Penicillin resistance was defined as a MIC of 2 µg/ml. All isolates were tested for susceptibilities to penicillin, erythromycin, amoxicillin, cefotaxime, ceftriaxone, cefuroxime, meropenem, chloramphenicol, tetracycline, clindamycin, linezolid, rifampin, ciprofloxacin, levofloxacin, telithromycin, quinupristin, dalfopristin, vancomycin, and trimethoprim-sulfamethoxazole.

Data analysis. Since the serologic difference between serotypes 6A and 6C has been conclusively shown to be due to distinct wciN genes within the respective cps6A and cps6C loci (13), and as described below, we found concordance between PCR and serologic 6C testing results in extensive comparisons. We refer to all CS6As that are wciN_6C positive as serotype 6C throughout this report. We calculated annual incidence rates of IPD (number of cases per 100,000-person population) for 1999 using U.S. Census Bureau population estimates as denominators. Rates for 2006 and 2007 were based on race-bridged postcensus 2006 population estimates from the National Center for Health Statistics (http://www.cdc.gov/nchs/). Serotype-specific incidence rates were adjusted for cases with missing isolates, based on the distribution of serotypes for cases with available isolates. We compared serotype-specific incidence rates in 2007 to rates in 2006 and 1999 by calculating relative risks and 95% confidence intervals (CI) expressed as percent changes in rates of disease [(relative risk – 1) x 100%].

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Correlation between serologic and sequence-based 6C determination. Of the 432 CS6As (6A and 6C combined) that were recovered during the years 1999 and 2006 and subjected to 6C-specific PCR testing (Table 1), 346 were previously tested using the MAb-based technique previously described (12). We observed 100% agreement between the 6C-positive and 6C-negative results obtained by the two different methods.

View this table: [in this window] [in a new window]

TABLE 1. Distribution of serotype 6A, 6B, and 6C isolates within serogroup 6 and serotype-specific IPD incidence rates during 1999, 2006, and 2007a

Changes in the incidence and distribution of IPD caused by serogroup 6 serotypes. In 1999 (PCV7 was not implemented until 2000), there were 4,524 reported IPD cases in a population of 18.6 million individuals, with conventionally serotyped isolates from 3,930 of those cases (86.9%). Of these IPD isolates, 214 (5.4%) were CS6As. In 2006, there were 3,936 reported IPD cases in a population of 28.2 million individuals, with isolates from 3,463 cases (88.0%) available for serotyping. In 2007, there were 4,010 reported IPD cases (also from the 2006 population estimate of 28.2 million), with isolates from 3,457 (86.2%) available for serotyping. Of the 6,920 year 2006 and 2007 isolates, 422 (6%) were found to be CS6As.

We developed a multiplexed PCR assay (Fig. 1) for assessing all 636 CS6A isolates recovered from 1999, 2006, and 2007 surveillance. This assay detected pneumococcal species (160-bp cpsA fragment) and serogroup 6 (250-bp wciP fragment) as described previously (11). This assay also included a 6C-specific PCR primer pair (727-bp fragment) specific to the previously described wciN_6C gene (13). The isolates that were evaluated included the 332 isolates from years 1999 and 2006 that were tested by the MAb assay in our recent study (12). We also tested a total of 66 serotype 6B isolates recovered from 2005 to 2007 for the presence of the wciN_6C gene, including all 51 available from 2006 to 2007.

A dramatic decrease in the incidence of serotype 6B IPD was observed between 1999 and 2007 (94% reduction [95% CI, –96 to –91%]; absolute rate reduction of 1.5 cases per 100,000) among all age groups (Table 1), coinciding with widespread PCV7 implementation, with no significant changes observed between 2006 and 2007 (16% reduction [95% CI, –49 to 41%]).

The incidence of serotype 6A IPD also declined in all age groups, with an overall decrease from 1.1 cases per 100,000 in 1999 (pre-PCV7) to 0.3 cases per 100,000 in 2007 (76% reduction [95% CI, –82 to –69%]; absolute rate reduction of 0.8 cases per 100,000) and did not change significantly from 2006 to 2007 (16% reduction [95% CI, –39 to 13%]) (Table 1).

The overall incidence of serotype 6C IPD increased significantly from 0.22 cases per 100,000 in 1999 to 0.58 cases per 100,000 in 2007 (164% increase [95% CI, 87 to 270%]) (Table 1). Even though percent increases were large for all age groups, absolute rate changes were very small (0.52 and 0.35 cases per 100,000, among children of <5 years of age and persons of 5 years of age, respectively). Between 2006 and 2007, no significant changes in the incidence of serotype 6C IPD occurred (2% increase [95% CI, –18 to 27%]).

The majority of IPD cases in the United States due to serogroup 6 during 1999 were caused by serotype 6B (55.3%), followed by serotype 6A (37.2%) (Table 1). Serotype 6C accounted for only a small percentage (7.5%) of serogroup 6 IPD cases in 1999, with no type 6C IPD isolates recovered from individuals of <5 years of age. In 2007, serotype 6C accounted for the largest proportion of serogroup 6 IPD cases overall (62.1%) and in each age group, followed by serotypes 6A (27.8%) and 6B (10.1%) (Table 1).

Absence of the 6C-specific determinant among serotype 6B isolates. The serotype 6A and 6B capsules are very similar structurally, and their respective biosynthetic loci are nearly identical at the DNA sequence level (8). Nonetheless, we found that all 66 serotype 6B isolates tested from years 2005 to 2007 in ABCs areas (including the 52 year 2006 and 2007 6B isolates in Table 1) tested negative for the presence of the wciN_6C gene.

Penicillin nonsusceptibility in serotypes 6A and 6C. In 1999, 83 of 179 (46.4%) 6A isolates were penicillin nonsusceptible, compared to only 4 of 35 (11.4%) 6C isolates (Table 2). In 2006 and 2007, 79 of 140 (56.4%) 6A isolates were penicillin nonsusceptible, compared to 90 of 282 (31.9%) 6C isolates. Interestingly, the prevalence of full penicillin resistance within 6A isolates decreased from 17.3% in 1999 to 7.1% in 2006 and 2007. Full penicillin resistance within 6C was not detected during 1999, but it accounted for 8 of 282 isolates (2.8%) during 2006 and 2007.

View this table: [in this window] [in a new window]

TABLE 2. Changing proportions of penicillin-nonsusceptiblea isolates within serotype 6A and 6C IPD isolates in 2006 and 2007 relative to those in 1999

Distribution of MLST types within a sampling of serotype 6C invasive isolates. MLST types are defined by specific combinations of seven housekeeping alleles (for the genes aroE, gdh, gki, recP, spi, xpt, and ddl, as shown in Table 3). For a set of 42 6C isolates representing several different antibiotic susceptibility patterns (only data for penicillin and erythromycin are shown), we found that six genetic groups (depicted in Table 3 as clonal complexes I to III or individual MLST types 1390, 395, and 376) were represented. These groups were unrelated in that no individual MLST type within one genetic group shared more than three identical alleles with another MLST type within one of the other five genetic groups. Each of these six distinct genetic groups consisted of one or more MLST types that shared at least five identical housekeeping gene alleles with all other members of the group. A total of 12 MLST types were found (including the three new MLST types ST3674, ST3675, and ST3676) within the 42-isolate sampling (Table 3). Seven of the nine previously known MLST types are associated solely or primarily with CS6As at http://www.mlst.net. Only ST1092 (observed within serotype 6B isolates) (8) and ST2064 have not been previously associated with CS6As (we also note the association of ST1092 with serotype 6C at http://www.mlst.net from independent researchers). We found that serotype 6C MLST types within four of these groups are shared with invasive serotype 6A isolates from our surveillance. Specifically, MLST types 376, 395, 473, and 1292 were found in both serotypes 6A and 6C (Table 3). The six penicillin-resistant 6C isolates tested represented six different MLST types distributed among four of the six genetic sets found (Table 2).

View this table: [in this window] [in a new window]

TABLE 3. MLST types of 42 serotype 6C ABCs isolates and observed overlap with ABCs serotype 6A isolates from 1999 to 2007

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
It is important to conduct surveillance for invasive disease caused by serotype 6C, since PCV7 does not appear to protect against this serotype (14). For evaluation of PCV7 and increased-valency conjugate vaccines projected to be licensed in the near future, it is vital to determine if disease cases caused by CS6As are true serotype 6A "vaccine failures" or are actually caused by serotype 6C strains. Here, we present a reliable PCR-based method for detecting serotype 6C isolates. We feel that this method has wide utility for pneumococcal surveillance due to its simplicity, ease of use, and accuracy. We have incorporated the serotype 6C surveillance protocol for all subsequent CS6As that we encounter through ABCs and are in the process of using this PCR assay to retrospectively resolve the serotype 6C isolates from all CS6As recovered through ABCs since 1999.

Recent results (12) and the results presented here demonstrate that while serotype 6A IPD incidence decreased significantly in postvaccine years, there has also been a small but significant increase in serotype 6C IPD incidence. While the incidence of type 6C IPD more than doubled between 1999 and 2007, incidence during 2007 remained low. There was a stepwise annual increase in 6C IPD incidence in individuals 5 years of age or older during the period 2004 to 2006; however, incidence in children younger than 5 years of age was very low, with no clear trend apparent (12). In 1999, total 6C IPD incidence was very low and was not detectable in individuals younger than 5 years of age (Table 1). The overall incidence of serotype 6A and 6B IPD continued to decrease, although not significantly, between 2006 and 2007. It is remarkable that serotype 6C is now by far the most prevalent serogroup 6 serotype causing IPD (Table 1). This observation is primarily a testament to the efficacy of PCV7 against serotypes 6A and 6B, but it also serves as an alert to the fact that PCV7 does not protect against serotype 6C IPD (12). While penicillin-resistant serotype 6C isolates are still uncommon compared to serotype 6A isolates, we have now detected penicillin-resistant serotype 6C isolates within four of the six genetic complexes observed within the isolates of this serotype (Table 2).

Based upon current available information, it is not completely clear which of the three serogroup 6 serotypes was the ancestral serotype, and we do not wish to make implications regarding this point in this report. The observation that the wciN_6C gene was not detected among 66 conventionally serotyped 6B IPD isolates recovered from 2005 to 2007 is compatible with the notion that the wciN_6C-dictated structural alteration of the serotype 6B capsule does not confer a selective advantage or that this alteration could even confer a selective disadvantage. Alternatively, it is possible that the wciN_6C gene replacement imposed upon the serotype 6B capsular locus would change the classically determined 6B serotype to nontypeable or to the 6A serotype. Studies are ongoing to answer these questions. It is interesting that ST1092 and an ST1092 single-locus variants were observed among three of the 6C isolates described here. Although ST1092 has been associated with multiple serotype 6B isolates (see http://www.mlst.net), these three CS6As tested positive for 6C in a previous study (1) with the MAb Hyp6AG1 (data not shown), which has been shown to recognize exclusively CS6As and not serotype 6B strains (2, 13).

As described recently (12), there was a significantly greater proportion of penicillin-resistant isolates within serotype 6A (16%) than within serotype 6C (2%) when comparing cumulative 1999, 2003, and 2006 data. These data relied heavily upon year 1999 isolates, since there were many more type 6A isolates recovered during this time (Table 1) and full penicillin resistance was overrepresented among children of <5 years of age (data not shown). We show here that intermediate and full penicillin resistance was considerably more common within serotype 6C in 2006 and 2007 than in 1999. The proportion of intermediately resistant 6C isolates increased from 11% to about 30%, while fully resistant isolates were not detectable among isolates in 1999 but were present at about 3% of isolates in 2006 and 2007 (Table 2). It was interesting to note that while intermediate penicillin resistance also increased within serotype 6A, full resistance decreased considerably (Table 2).

Based upon combined MLST and pulsed-field gel electrophoresis of chromosomal digests, we have found that ST376 (North Carolina^6A-23 [see http://www.sph.emory.edu/PMEN/pmen_table2.html]), accounted for approximately 30% of CS6As, including the majority of fully penicillin-resistant isolates and the majority of erythromycin-resistant isolates present within the serotype (1, 6). There was only one instance of the genotype ST376 among the 42 serotype 6C isolates genotyped within one of six penicillin-resistant serotype 6C isolates tested (Table 3), indicating that ST376 is probably more common within serotype 6A than in 6C.

It is not surprising that the genotypes thus far encountered among serotype 6C ABCs isolates are historically associated with serotype 6A (with the exception of ST1092, which is associated with serotype 6B according to listings at http://www.mlst.net), since CS6As represent both 6A and 6C serotypes (14). It is very interesting to observe, however, that MLST types 376, 395, 473, and 1292 are shared among both current serotype 6A and 6C IPD isolates recently identified from our national surveillance (Table 1). It is generally accepted that serotype switching is a relatively rare event in nature (9). Individual switches in capsular serotype have been shown to occur through the replacement of the chromosomal capsular biosynthetic (cps) locus by means of recombinational double-crossover events between the donor and recipient at specific points flanking the corresponding loci, giving clear evidence of complete genetic replacement of entire large (>20 kb) cps loci and flanking sequences (2, 4). Previous findings (13) based upon sequence analysis of serotype 6A and 6C cps loci suggested that the 6C capsule type originated decades ago by a single recombination event in a 6A locus in which the 1.2-kb cps-internal glycosyl transferase gene (wciN_6A) was replaced by a gene of unknown origin (wciN_6C). The observation of four MLST types shared among contemporary 6A and 6C strains, in which the one major genetic difference between them is a different wciN gene, suggests the occurrence of at least four independent conversions of serotype 6A to 6C involving exclusively the shuttling of the wciN_6C element between CS6As. These four presumed serotype switches differ from those previously reported, in that each switch may have arisen through a double-crossover event within cps locus sites flanking wciN, rather than sites flanking the intact cps loci, affecting replacement of wciN_6A with the unrelated wciN_6C gene.

While increases in serotype 6C IPD rates observed to date have not been large enough to suggest that this serotype will emerge as a predominant invasive serotype, there are potentially predisposing factors associated with this serotype. First, unlike the cross protection observed between serotypes 6B and 6A, previously reported data (12) and the data reported here show that PCV7 is not effective in preventing IPD caused by serotype 6C. Additionally, penicillin resistance (MIC 2 µg/ml, by 2007 CLSI standards) has been detected within four different genetic groups of serotype 6C isolates, and about 30% of 6C isolates recovered during 2006 and 2007 are nonsusceptible to penicillin (Table 2) and/or macrolides (data not shown). Decreased susceptibility to antibiotics could provide a selective advantage to one or more specific clonal types. The clonal diversity apparent within serotype 6C isolates is another potential predisposing factor (Table 3). The presence of six genetic complexes found among a limited sampling of only 42 6C isolates indicates that like serotype 6A (1, 6), this is a genetically diverse serotype. It is striking that MLST types 376, 395, 473, and 1292 and related isolates together accounted for 42 to 79% of ABCs invasive CS6As recovered in 1999, 2001, and 2002 (1). Because a relatively small subset of isolates was genotyped, it is important to note that serotype 6C could represent all 12 genetic complexes previously observed within serotype 6A IPD isolates recovered in the United States (1). On the other hand, it is also conceivable that ST1390 and complex III types found in this study exclusively in 6C isolates (Table 3) are not found within serotype 6A. The fact that the 6C serotype has been detected within strains with four genotypes shared with 6A strains that have proven invasive potential further indicates the need to closely monitor the clonal structure and epidemiology of serotype 6C pneumococci. We feel that the 6C-specific PCR assay described here reliably assists these efforts.

 
We sincerely thank the Active Bacterial Core surveillance personnel for data collection, the Centers for Disease Control and Prevention Antimicrobial Resistance Working Group for the necessary resources for the work, and Matt Moore for critically reading the manuscript. We are indebted to all of the hospitals and laboratories participating in the CDC's Emerging Infections Program (EIP) network and the EIP core program, ABCs. We thank Carolyn Wright and other CDC ABCs/EIP members for providing isolate information. We are grateful for the global pneumococcal MLST homepage database resource (Imperial College, London, United Kingdom; funded by the Wellcome Trust). The ABCs team is represented here by the following members: Monica M. Farley, Emory University School of Medicine and the Veterans Affairs Medical Center, Atlanta, GA; James Hadler, Connecticut Department of Public Health, Hartford, CT; Lee H. Harrison, University of Pittsburgh, Pittsburgh, PA; Nancy M. Bennett, University of Rochester, Rochester, NY; Ruth Lynfield and John Besser, Minnesota Department of Health, Minneapolis, MN; Arthur Reingold, School of Public Health, University of California, Berkeley, CA; Ann Thomas, Oregon Department of Human Services, Portland, OR; Allen Craig, Tennessee Department of Health; and James H. Jorgensen, University of Texas Health Science Center, San Antonio, TX; Ken Gershman, Colorado Department of Public Health and Environment, Denver, CO; Joan Baumbach, New Mexico Department of Health, Santa Fe, NM. The University of Alabama at Birmingham has applied for a patent for the discovery of the 6C serotype (M.H.N.).

This work was partially funded by NIH grant R01 AI-31473 (M.H.N.).

 
* Corresponding author. Mailing address: Respiratory Diseases Branch, Division of Bacterial Diseases, 1600 Clifton Rd. NE, Mailstop C02, Atlanta, GA 30329. Phone: (404) 639-1237. Fax: (404) 639-4215. E-mail: BBeall{at}CDC.gov

Published ahead of print on 30 December 2008.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1
1. Beall, B., M. C. McEllistrem, R. E. Gertz, Jr., S. Wedel, D. J. Boxrud, A. L. Gonzalez, M. J. Medina, R. Pai, T. A. Thompson, L. H. Harrison, L. McGee, and C. G. Whitney. 2006. Pre- and postvaccination clonal compositions of invasive pneumococcal serotypes for isolates collected in the United States in 1999, 2001, and 2002. J. Clin. Microbiol. 44:999-1017.[Abstract/Free Full Text]
2
2. Brueggemann, A. B., R. Pai, D. W. Crook, and B. Beall. 2007. Vaccine escape recombinants emerge after pneumococcal vaccination in the United States. PLoS Pathog. 3:e168.[CrossRef][Medline]
3
3. Clinical and Laboratory Standards Institute. 2007. Performance standards for antimicrobial susceptibility testing; 15th informational supplement. Approved standard M100-S17. Clinical and Laboratory Standards Institute, Wayne, PA.
4
4. Coffey, T. J., M. C. Enright, M. Daniels, J. K. Morona, R. Morona, W. Hryniewicz, J. C. Paton, and B. G. Spratt. 1998. Recombinational exchanges at the capsular polysaccharide biosynthetic locus lead to frequent serotype changes among natural isolates of Streptococcus pneumoniae. Mol. Microbiol. 27:73-83.[CrossRef][Medline]
5
5. Enright, M. C., and B. G. Spratt. 1998. A multilocus sequence typing scheme for Streptococcus pneumoniae: identification of clones associated with serious invasive disease. Microbiology 144:3049-3060.[Abstract/Free Full Text]
6
6. Gertz, R. E., M. C. McEllistrem, D. J. Boxrud, Z. Li, V. Sakota, T. A. Thompson, R. R. Facklam, J. M. Besser, L. H. Harrison, C. G. Whitney, and B. Beall. 2003. Clonal distribution of invasive pneumococcal isolates from children and selected adults in the United States prior to 7-valent conjugate vaccine introduction. J. Clin. Microbiol. 41:4194-4216.[Abstract/Free Full Text]
7
7. Lin, J., M. S. Kaltoft, A. P. Brandao, G. Echaniz-Aviles, M. C. C. Brandileone, S. K. Hollingshead, W. H. Benjamin, Jr., and M. H. Nahm. 2006. Validation of a multiplex pneumococcal serotyping assay with clinical samples. J. Clin. Microbiol. 44:383-388.[Abstract/Free Full Text]
8
8. Mavroidi, A., D. Godoy, D. M. Aanensen, D. A. Robinson, S. K. Hollingshead, and B. G. Spratt. 2004. Evolutionary genetics of the capsular locus of serogroup 6 pneumococci. J. Bacteriol. 186:8181-8192.[Abstract/Free Full Text]
9
9. Meats, E., A. B. Brueggemann, M. C. Enright, K. Sleeman, D. T. Friggiths, D. W. Crook, and B. G. Spratt. 2003. Stability of serotypes during nasopharyngeal carriage of Streptococcus pneumoniae. J. Clin. Microbiol. 41:386-392.[Abstract/Free Full Text]
10
10. Moore, M. R., R. E. Gertz, Jr., R. L. Woodbury, G. A. Barkocy-Gallagher, W. Schaffner, C. Lexau, K. Gershman, A. Reingold, M. Farley, L. H. Harrison, J. L. Hadler, N. M. Bennett, A. R. Thomas, L. McGee, T. Pilishvili, A. B. Brueggemann, C. G. Whitney, J. H. Jorgensen, and B. Beall. 2008. Population snapshot of emergent Streptococcus pneumoniae serotype 19A in the United States, 2005. J. Infect. Dis. 197:1016-1027.[CrossRef][Medline]
11
11. Pai, R., R. E. Gertz, and B. Beall. 2006. Sequential multiplex PCR approach for determining capsular serotypes of Streptococcus pneumoniae isolates. J. Clin. Microbiol. 44:124-131.[Abstract/Free Full Text]
12
12. Park, I. H., M. R. Moore, J. J. Treanor, S. I. Pelton, T. Pilishvili, B. W. Beall, M. A. Shelly, B. E. Mahon., and M. H. Nahm. 2008. Differential effects of pneumococcal vaccines against serotypes 6A and 6C. J. Infect. Dis. 198:1818-1822.[CrossRef][Medline]
13
13. Park, I. H., S. Park, S. K. Hollingshead, and M. H. Nahm. 2007. Genetic basis for the new pneumococcal serotype, 6C. Infect. Immun. 75:4482-4489.[Abstract/Free Full Text]
14
14. Park, I. H., D. G. Pritchard, R. Cartee, A. Brandao, M. C. Brandileone, and M. H. Nahm. 2007. Discovery of a new capsular serotype (6C) within serogroup 6 of Streptococcus pneumoniae. J. Clin. Microbiol. 45:1225-1233.[Abstract/Free Full Text]

---

Journal of Clinical Microbiology, March 2009, p. 554-559, Vol. 47, No. 3
0095-1137/09/$08.00+0     doi:10.1128/JCM.01919-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Jin, P., Xiao, M., Kong, F., Oftadeh, S., Zhou, F., Liu, C., Gilbert, G. L. (2009). Simple, Accurate, Serotype-Specific PCR Assay To Differentiate Streptococcus pneumoniae Serotypes 6A, 6B, and 6C. J. Clin. Microbiol. 47: 2470-2474 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by da Gloria Carvalho, M. Search for Related Content PubMed PubMed Citation Articles by da Gloria Carvalho, M.