Author's Correction for Damen et al., J. Clin. Microbiol. 46 (12) 3997-4003.
This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Damen, M.
Right arrow Articles by Beld, M.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Damen, M.
Right arrow Articles by Beld, M.

 Previous Article

Journal of Clinical Microbiology, March 2009, p. 875, Vol. 47, No. 3
0095-1137/09/$08.00+0     doi:10.1128/JCM.00016-09

AUTHOR'S CORRECTION

Real-Time PCR with an Internal Control for Detection of All Known Human Adenovirus Serotypes

Marjolein Damen, René Minnaar, Patricia Glasius, Alwin van der Ham, Gerrit Koen, Pauline Wertheim, and Marcel Beld

Laboratory of Clinical Virology, Department of Medical Microbiology, Academic Medical Centre, University of Amsterdam, Amsterdam, The Netherlands; Laboratory of Medical Microbiology, OLVG, Amsterdam, The Netherlands; and Laboratory of the Municipal Health Service, GGD Amsterdam, Amsterdam, The Netherlands

Volume 46, no. 12, p. 3997-4003, 2008. Page 4001, legend of Fig. 2, lines 3 and 4: "probe sequence, CCGGTCTGGTGCAATTCGCCCGC" should read "probe sequence, CCGGGTCTGGTGCAGTTTGCCCGC."

Journal of Clinical Microbiology, March 2009, p. 875, Vol. 47, No. 3
0095-1137/09/$08.00+0     doi:10.1128/JCM.00016-09





This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Damen, M.
Right arrow Articles by Beld, M.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Damen, M.
Right arrow Articles by Beld, M.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»