This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hodgson, K.
Right arrow Articles by Norton, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hodgson, K.
Right arrow Articles by Norton, R.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, May 2009, p. 1578-1580, Vol. 47, No. 5
0095-1137/09/$08.00+0     doi:10.1128/JCM.02507-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Comparison of Routine Bench and Molecular Diagnostic Methods in Identification of Burkholderia pseudomallei{triangledown}

Kelly Hodgson,1 Cathy Engler,2 Brenda Govan,1 Natkunam Ketheesan,1 and Robert Norton2*

School of Veterinary & Biomedical Sciences, James Cook University, Townsville, Queensland, Australia 4814,1 Microbiology, Pathology Queensland, Townsville Hospital, Townsville, Queensland, Australia 48142

Received 31 December 2008/ Returned for modification 14 February 2009/ Accepted 28 February 2009


arrow
ABSTRACT
 
This study compared the identification of Burkholderia pseudomallei with that of related organisms. Bench tests and latex agglutination were compared with molecular identification. Using bench tests and latex agglutination alone, 100% (30/30) of B. pseudomallei isolates were correctly identified. Amoxicillin-clavulanate susceptibility testing was also a good and simple discriminatory test.


arrow
TEXT
 
Melioidosis is an infectious disease caused by Burkholderia pseudomallei, which is endemic in Southeast Asia and northern Australia. Cases occur mainly during periods of heavy rain (13). It is a clinically diverse infection affecting many organ systems and commonly presents as a fulminant septicemia (3, 4).

There has been controversy as to the optimal identification system for B. pseudomallei (2, 9, 10, 11, 12, 19). The reliability of the API 20NE and the Vitek 1 systems (bioMérieux, Marcy L'Etoile, France) has been questioned and molecular confirmation suggested (14). The reliability of presumptive tests (oxidase, Gram staining, resistance to gentamicin and polymyxin) in the identification of this organism has previously been described as 100% accurate (6). It should be noted that neither system will distinguish related species such as Burkholderia thailandensis from B. pseudomallei.

The commonest misidentification of B. pseudomallei when using identification systems is with Burkholderia cepacia, Pseudomonas aeruginosa, Pseudomonas fluorescens, and Chromobacterium spp. (1). A recent study compared the API 20NE system and a latex agglutination assay and found that the API 20NE system identified 99% of B. pseudomallei isolates correctly. It did not however distinguish between B. thailandensis and B. pseudomallei. The addition of the latex agglutination test correctly identified 99.5% of isolates and was negative for 98% of the B. thailandensis isolates and other oxidase-positive gram-negative bacilli (1). Molecular identification of the organism has been described, using a number of genomic targets (14, 17, 18).

A previous study compared basic bench diagnostic presumptive tests with B. pseudomallei slide agglutination using a monoclonal antibody, API 20NE (bioMérieux, Marcy L'Etoile, France), cellular fatty acid analysis, and molecular detection (10). This showed that the PCR alone had a sensitivity and specificity of 100%. API 20NE performed poorly in this study, with a sensitivity of 37% and a specificity of 92% (10). The agglutination test used had a sensitivity of 94% and a specificity of 83%. Although fatty acid analysis had a sensitivity of 98% and a specificity of 83%, it was acknowledged that this technology was not widely available. Interestingly, the presumptive tests (oxidase, Gram staining, resistance to gentamicin and polymyxin) did not distinguish between B. pseudomallei, B. cepacia, and B. thailandensis. The aim of this study was to compare the diagnostic efficacies of standard presumptive identification methods (oxidase, gentamicin resistance, and amoxicillin-clavulanate susceptibility), including a specific latex agglutination assay, with specific molecular detection in the identification of B. pseudomallei to determine whether low-cost nonmolecular techniques may still be useful in resource-poor areas for the diagnosis of melioidosis.

Of the total of 43 bacterial isolates used, 30 were B. pseudomallei, three were B. cepacia, five were B. thailandensis, one was Chromobacterium violaceum (nonpigmented), and four were P. aeruginosa. All isolates were clinical isolates except for the B. thailandensis isolates, which were of environmental origin. Burkholderia mallei, a closely related species, was not used as a comparator because it is not misidentified as B. pseudomallei or vice versa with identification systems. It is also susceptible to gentamicin. All B. pseudomallei isolates investigated were from North Queensland. The identity of all isolates was confirmed using the Vitek 1 and API 20NE systems, and the isolates were stored at –70°C. These isolates had been validated in a previous study (12). The sequenced B. pseudomallei K96243 isolate was used as a control for real-time PCR. All isolates were subcultured onto Columbia horse blood agar (bioMérieux, Australia), incubated in air at 37°C for 24 h, and checked for purity. Single colonies were inoculated into Mueller-Hinton broth (bioMérieux, Australia) and incubated at 37°C for 24 h. Mueller-Hinton agar (bioMérieux, Australia) was used for susceptibility testing. All isolates were coded to ensure that the operator performing the identification was unaware of the identity of the isolate. Oxidase tests were performed by a standard oxidase reagent-impregnated strip method with appropriate controls. Susceptibility testing was carried out using a standard method with discs containing 20/10 µg amoxicillin-clavulanate and 10 µg gentamicin (5). The plates were incubated in air at 37°C for 24 h. As there are no CLSI zone diameter standards for B. pseudomallei, the standards for P. aeruginosa and Enterobacteriaceae were used. Zones of inhibition to gentamicin of ≥15 mm and to amoxicillin-clavulanate of ≥18 mm were considered susceptible (5). The latex reagent and the techniques used have been reported in detail in a previous study (1). PCR amplification was performed as previously described, with similar primers and probes (17), using Rotor-Gene 3000 (Corbett Life Science, Australia) with minor modifications. Bovine serum albumin was not added to the master mix. ImmoMix Taq (Bioline) was used with deoxynucleoside triphosphate (200 µM) at a final MgCl2 concentration of 2.5 mM.

The following primers and probes were used: primer BPSS1187/BURPS1710b_A0179 (B. pseudomallei-unique sequence) (forward, ATCGAATCAGGGCGTTCAAG; reverse, CATTCGGTGACGACACGACC) and probe 6-carboxyfluorescein-CGCCGCAAGACGCCATCGTTCAT-6-carboxytetramethylrhodamine. The probe is labeled with a reporter dye, 6-carboxyfluorescein, and a quencher dye, 6-carboxytetramethylrhodamine.

A total of 33 isolates were presumptively identified as B. pseudomallei on the basis of a positive oxidase test, resistance to gentamicin, and susceptibility to amoxicillin-clavulanate. These included four of the five B. thailandensis isolates and 29 of the 30 B. pseudomallei isolates (Table 1). One of the B. thailandensis isolates was not presumptively identified as B. pseudomallei as expected, due to a reduced zone of inhibition to amoxicillin-clavulanate. One of the B. pseudomallei isolates failed to be presumptively identified as B. pseudomallei, as it had a zone of inhibition to gentamicin of 22 mm. Nevertheless, it was confirmed with both latex agglutination and quantitative real-time PCR. B. pseudomallei is intrinsically resistant to gentamicin, although rare isolates which are susceptible to gentamicin have been described (16). When presumptive identification was compared with definitive identification (Table 1), presumptive identification had a sensitivity of 97%, a specificity of 69%, a positive predictive value of 88%, and a negative predictive value of 90% (P < 0.0001; Fisher's exact test). If B. thailandensis isolates were excluded, presumptive identification would have a specificity of 100% and a sensitivity of 97%.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Isolates presumptively and definitively identified as B. pseudomallei

We used amoxicillin-clavulanate susceptibility rather than colistin resistance to distinguish between B. cepacia (resistant) and B. pseudomallei (sensitive). When tested against amoxicillin-clavulanate, 93.6% (278/297) of B. cepacia isolates tested over a 10-year period were resistant (Antibiogram, Pathology Queensland; unpublished data). All isolates of B. pseudomallei, in this study, tested susceptible to amoxicillin-clavulanate. A previous study also demonstrated that 100% (69/69) of B. pseudomallei isolates were susceptible to amoxicillin-clavulanate (15). Colistin, on the other hand, does not reliably distinguish B. cepacia from B. pseudomallei, as both are almost invariably resistant (7).

It is acknowledged that the number of isolates tested in this study is small and that the results need to be interpreted with caution. Nevertheless, this study has demonstrated that presumptive tests are highly predictive in the identification of B. pseudomallei. While presumptive identification will misidentify B. thailandensis as B. pseudomallei, this is unlikely to be of clinical significance, as B. thailandensis is rarely recovered from clinical specimens (8). The use of amoxicillin-clavulanate susceptibility testing for presumptive identification of B. pseudomallei has not been described previously. Combined with a latex agglutination assay, it would further validate the identification of B. pseudomallei. Therefore, we conclude that these tests lend themselves to be used in regions where kit identification methods are costly and where sustainable molecular detection techniques are unrealistic.


arrow
ACKNOWLEDGMENTS
 
We are grateful to Tim Inglis, PathCentre, Perth, Australia, for providing the strains of B. thailandensis. We also acknowledge Surasakdi Wongratanacheewin of Khon Kaen University, Thailand, for providing the latex agglutination reagent and Jenny Elliman of James Cook University, Australia, for the technical assistance with real-time PCR.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Microbiology, Pathology Queensland, The Townsville Hospital, Townsville, Qld 4814, Australia. Phone: 61 (07) 47 961111. Fax: 61 (07) 47 962415. E-mail: Robert_Norton{at}health.qld.gov.au Back

{triangledown} Published ahead of print on 11 March 2009. Back


arrow
REFERENCES
 
    1
  1. Amornchai, P., W. Chierakul, V. Wuthiekanun, Y. Mahakhunkijcharoen, R. Phetsouvanh, B. J. Currie, P. N. Newton, N. van Vinh Chau, S. Wongratanacheewin, N. P. J. Day, and S. J. Peacock. 2007. Accuracy of Burkholderia pseudomallei identification using the API 20NE system and a latex agglutination test. J. Clin. Microbiol. 45:3774-3776.[Abstract/Free Full Text]
  2. 2
  3. Ashdown, L. 1979. Identification of Pseudomonas pseudomallei in the clinical laboratory. J. Clin. Pathol. 32:500-504.[Abstract/Free Full Text]
  4. 3
  5. Chaowagul, W., N. J. White, D. A. B. Dance, Y. Wattanagoon, P. Naigowit, T. M. E. Davis, S. Looareesuwan, and N. Pitakwatchara. 1989. Melioidosis: a major cause of community-acquired septicemia in northeastern Thailand. J. Infect. Dis. 159:890-899.[Medline]
  6. 4
  7. Cheng, A., and B. Currie. 2005. Melioidosis: epidemiology, pathophysiology, and management. Clin. Microbiol. Rev. 18:383-416.[Abstract/Free Full Text]
  8. 5
  9. Clinical and Laboratory Standards Institute. 2008. Performance standards for antimicrobial susceptibility testing; 18th informational supplement. CLSI document M100-S18. Clinical and Laboratory Standards Institute, Wayne, PA.
  10. 6
  11. Dance, D. A., V. Wuthiekanun, P. Naigowit, and N. J. White. 1989. Identification of Pseudomonas pseudomallei in clinical practice: use of simple screening tests and API 20NE. J. Clin. Pathol. 42:645-648.[Abstract/Free Full Text]
  12. 7
  13. Gales, A. C., A. O. Reis, and R. N. Jones. 2001. Contemporary assessment of antimicrobial susceptibility testing methods for polymyxin B and colistin: review of available interpretative criteria and quality control guidelines. J. Clin. Microbiol. 39:183-190.[Abstract/Free Full Text]
  14. 8
  15. Glass, M. B., J. E. Gee, A. G. Steigerwalt, D. Cavuoti, T. Barton, R. D. Hardy, D. Godoy, B. G. Spratt, T. A. Clark, and P. P. Wilkins. 2006. Pneumonia and septicemia caused by Burkholderia thailandensis in the United States. J. Clin. Microbiol. 44:4601-4604.[Abstract/Free Full Text]
  16. 9
  17. Inglis, T. J., D. Chiang, G. S. Lee, and L. Chor-Kiang. 1998. Potential misidentification of Burkholderia pseudomallei by API 20NE. Pathology 30:62-64.[CrossRef][Medline]
  18. 10
  19. Inglis, T. J., A. Merritt, G. Chidlow, M. Aravena-Roman, and G. Harnett. 2005. Comparison of diagnostic laboratory methods for identification of Burkholderia pseudomallei. J. Clin. Microbiol. 43:2201-2206.[Abstract/Free Full Text]
  20. 11
  21. Kiratisin, P., P. Santanirand, N. Chantratita, and S. Kaewdaeng. 2007. Accuracy of commercial systems for identification of Burkholderia pseudomallei versus Burkholderia cepacia. Diagn. Microbiol. Infect. Dis. 59:277-281.[CrossRef][Medline]
  22. 12
  23. Lowe, P., C. Engler, and R. Norton. 2002. A comparison of automated and nonautomated identification systems for Burkholderia pseudomallei. J. Clin. Microbiol. 40:4625-4627.[Abstract/Free Full Text]
  24. 13
  25. Malczewski, A. B., K. M. Oman, R. E. Norton, and N. Ketheesan. 2005. Clinical presentation of melioidosis in Queensland, Australia. Trans. R. Soc. Trop. Med. Hyg. 99:856-860.[CrossRef][Medline]
  26. 14
  27. Merritt, A., T. J. Inglis, G. Chidlow, and G. Harnett. 2006. PCR based identification of Burkholderia pseudomallei. Rev. Inst. Med. Trop. Sao Paulo 48:239-244.[Medline]
  28. 15
  29. Seymour-Murray, J., R. E. Norton, and C. Ashhurst-Smith. 1997. Comparative in vitro susceptibility of Burkholderia pseudomallei to cefpirome, ceftazidime and cefepime. Pathology 29:329-330.[CrossRef][Medline]
  30. 16
  31. Simpson, A. J., N. J. White, and V. Wuthiekanun. 1999. Aminoglycoside and macrolide resistance in Burkholderia pseudomallei. Antimicrob. Agents Chemother. 43:2332.[Free Full Text]
  32. 17
  33. Supaprom, C., D. Wang, C. Leelayuwat, W. Thaewpia, W. Susaengrat, V. Koh, E. Ooi, G. Lertmemongkolchai, and Y. Liu. 2007. Development of real-time PCR assays and evaluation of their potential use for rapid detection of Burkholderia pseudomallei in clinical blood specimens. J. Clin. Microbiol. 45:2894-2901.[Abstract/Free Full Text]
  34. 18
  35. Thibault, F., E. Valade, and D. Vidal. 2004. Identification and discrimination of Burkholderia pseudomallei, B. mallei, and B. thailandensis by real-time PCR targeting type III secretion system genes. J. Clin. Microbiol. 42:5871-5874.[Abstract/Free Full Text]
  36. 19
  37. Wuthiekanun, V., L. Anuntagool, N. White, and S. Sirisinha. 2002. A rapid method for the differentiation of Burkholderia pseudomallei and Burkholderia thailandensis. Am. J. Trop. Med. Hyg. 66:759-761.[Abstract]


Journal of Clinical Microbiology, May 2009, p. 1578-1580, Vol. 47, No. 5
0095-1137/09/$08.00+0     doi:10.1128/JCM.02507-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hodgson, K.
Right arrow Articles by Norton, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hodgson, K.
Right arrow Articles by Norton, R.