Author's Correction for Sperry et al., J. Clin. Microbiol. 46 (4) 1435-1450.
This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Google Scholar
Right arrow Articles by Sperry, K. E. V.
Right arrow Articles by Wolf, L. A.
PubMed
Right arrow Articles by Sperry, K. E. V.
Right arrow Articles by Wolf, L. A.

 Previous Article

Journal of Clinical Microbiology, June 2009, p. 1984, Vol. 47, No. 6
0095-1137/09/$08.00+0     doi:10.1128/JCM.00730-09

AUTHOR'S CORRECTION

Multiple-Locus Variable-Number Tandem-Repeat Analysis as a Tool for Subtyping Listeria monocytogenes Strains

Katharine E. Volpe Sperry, Sophia Kathariou, Justin S. Edwards, and Leslie A. Wolf

North Carolina State Laboratory of Public Health, Raleigh, North Carolina, and North Carolina State University, Raleigh, North Carolina

Vol. 46, no. 4, p. 1435-1450. Page 1442, Table 2, line 9, column 2: "D4" should read "D2."

Page 1442, Table 2, line 9, column 3: "TATTTACGGAAAAGACGTAG" should read "TACGCCAGTTCCTCCGTTAG."

Page 1442, Table 2, line 9, column 4: "CGTAACTGTCCTACCATTAG" should read "TTGAAAGCTGGAGATGTTATTCA."

Journal of Clinical Microbiology, June 2009, p. 1984, Vol. 47, No. 6
0095-1137/09/$08.00+0     doi:10.1128/JCM.00730-09





This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Google Scholar
Right arrow Articles by Sperry, K. E. V.
Right arrow Articles by Wolf, L. A.
PubMed
Right arrow Articles by Sperry, K. E. V.
Right arrow Articles by Wolf, L. A.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»