LETTER

Chronic fatigue syndrome (CFS) is an illness characterized by disabling and long-lasting fatigue and associated with several somatic symptoms such as myalgia, arthralgia, headache, recurrent sore throat, and neurocognitive dysfunction. Frequently, the onset of the illness is preceded by flu-like symptoms, which indicates that immune abnormalities or a viral infection might be involved in the pathogenesis. Although no specific agent has been definitively linked to CFS, several different viruses e.g., herpesviruses, enteroviruses, and retroviruses, have been investigated.

Human herpesvirus 6 (HHV-6) variant B is the cause of exanthema subitum, whereas variant A has not been definitely linked to any human disease. HHV-6 has been suggested to play a role in CFS, since patients with CFS have been shown to have signs of a more active HHV-6 infection than controls (4-6). It has also been suggested that infection with HHV-6 variant A is more common among patients with CFS than in controls (2, 8). Human herpesvirus 8 (HHV-8) is the most recently discovered human herpesvirus and is associated with Kaposi's sarcoma (1). A possible role for HHV-8 in CFS has not previously been investigated. In the present study, we have analyzed eight CFS patients (defined as described by Fukuda et al. [3]) with symptoms of infection at the onset of their illness and seven controls regarding HHV-6 DNA variant A and B and HHV-8 DNA in peripheral blood mononuclear cells (PBMC).

A total of 5 × 10⁶ PBMC from each patient were resuspended in a lysis buffer (10 mmol of Tris-HCl [pH 8.3] per liter; 1 mmol of EDTA per liter, 0.5% Nonidet P-40, 0.5% Tween 20, 0.3 µg of proteinase K per liter) to a concentration of 20,000 cells/µl. The cell suspension was incubated at +37°C overnight in order to lyse the cells. Ten microliters of the lysate (i.e., 200,000 cells) were used for each PCR after heat treatment at 95°C for 10 min in order to inactivate the proteinase K. Standard methods of avoiding contamination of samples were strictly followed, including the use of sterile conditions and geographically separate areas for preparation, amplification, and analysis. A variant specific nested HHV-6 PCR and a nested HHV-8 PCR were performed according to what has previously been described (1, 7), except that the inner primers for the HHV-8 PCR were changed to 5'ACGGATTTGACCCCGTGTTC3' and 5'AATGACACATTGGTGGTATA3'. Each patient sample was analyzed in duplicate. If only one of the duplicates was positive, the PCR was repeated and only if one or two of the duplicates were positive the second time was the sample considered positive.

The results were similar in the two groups, with two of eight (25%) of the CFS patients and two of seven (29%) of the controls being positive for HHV-6 variant B in PBMC. The frequency is similar to what has been found in previous investigations with the same method. No sample in any group contained detectable DNA from HHV-6 variant A or HHV-8. Our results suggest that active infection with HHV-6 or HHV-8 is not associated with CFS.