Article Figures & Data
Figures
- Fig. 1.
Spectrophotometric scan. (A) SPS at 0.0135% dissolved in water. (B) BacT Alert blood culture medium (0.1 ml) inoculated with blood was washed three times by centrifugation in 10 volumes of water (method F) and was then processed by the QIAmp blood digestion and DNA purification protocol (method B). Water eluate from the silica column, which normally contains purified DNA, was scanned.
- Fig. 2.
Effect of SPS concentration on PCR. Agarose gel electrophoresis of PCR products amplified from B. pertussistarget DNA with conserved bacterial 16S rRNA gene primers 516F and 13R in the presence of various concentrations of SPS in each PCR reaction, as listed, including no SPS (positive control). The amplification product size is about 874 bp.
- Fig. 3.
Amplification of bacterial DNA from blood cultures by four digestion and extraction methods. Agarose gel electrophoresis of PCR products amplified with 16S rRNA gene primers 516F and 13R. In the first four lanes, E. coli was inoculated into blood culture medium containing human blood and was processed by various digestion and purification protocols to produce target DNA for PCR. Lane 1, proteinase K digestion with phenol-chloroform extractions (method A); lane 2, Isoquick protocol (method C); lane 3, protocol with the QIAmp blood kit; (method B); lane 4, benzyl alcohol-guanidine hydrochloride extraction protocol (method D); lane 5, method D performed with sterile LB broth inoculated into blood culture medium (negative control); lane 6, method D performed with sterile LB broth added to TE buffer (negative control); lane 7, bacterial DNA-positive control; lane 8, 100-bp DNA ladder. The amplification product size is about 874 bp.
- Fig. 4.
Amplification controls. Agarose gel electrophoresis of PCR products amplified with 16S rRNA gene primers 516F and 13R (about 874 bp). E. coli was inoculated into blood culture medium containing human blood and processed by one of the four listed digestion and purification protocols. In the first five lanes, the processed DNA was diluted in sterile, UV-irradiated water as indicated, and 5 μl of DNA target were added to a 50-μl PCR mixture along with 1 μl of additional B. pertussis DNA. Lane Neg, unprocessed, sterile water (negative control); and Lane Pos, 1 μl (79 ng) of B. pertussis DNA (positive control) subjected to PCR. A 1-kb DNA ladder is present in the last lane.
- Fig. 5.
Comparison of two primer pairs used in PCR amplification. PCR was performed with primer pair 516F-806R (A) or 516F-13R (B), and the products were subjected to gel electrophoresis. One microliter of target was added to each 50-μl PCR mixture, as follows: 20,000 gene copies of E. coli 16S rDNA (lane 1), 2,000 gene copies (lane 2), 200 gene copies (lane 3), 20 gene copies (lane 4), DNA purified from uninoculated BacT Alert anaerobic blood culture medium by method D (lane 5), and 1-kb DNA ladder (lane 6).
- Fig. 6.
Phylogenetic trees. The 16S rRNA gene sequence amplified from uninoculated blood culture medium was aligned with other known 16S rRNA gene sequences, and phylogenetic relationships were inferred by using a maximum likelihood algorithm. The branch length is proportional to the evolutionary distance, and the bar labeled .10 represents 0.1 estimated base changes per position. (A) Sequence in BACTEC medium with 370 masked positions. S. pneumoniae was used as an outgroup. (B) Sequence in BacT Alert medium with 554 masked positions.B. subtilis was used as an outgroup.
Tables
- Table 1.
16S rRNA gene primers used for PCR and sequencing
Primer Sequence (5′→3′) E. colipositiona 516F TGCCAGCAGCCGCGGTAA 516–533 806F ATTAGATACCCTGGTAGTCC 787–806 806R GGACTACCAGGGTATCTAAT 806–787 911R GCCCCCGTCAATTCMTTTGA 930–911 1175F GAGGAAGGTGGGGATGACGT 1175–1194 1175R ACGTCATCCCCACCTTCCTC 1194–1175 13R AGGCCCGGGAACGTATTCAC 1390–1371 ↵a E. coli position numbers are based on reference 5.
