Article Figures & Data
Figures
- Fig. 1.
Agarose gel electrophoresis of PCR-amplified DNA fragments of the pbp2B gene from S. pneumoniae. Lane M, molecular size markers (in base pairs). The penicillin MICs for the isolates are as follows: 0.03 μg/ml (lane 1), 0.125 μg/ml (lane 2), 0.5 μg/ml (lane 3), 1 μg/ml (lane 4), and 2 μg/ml (lane 5).
- Fig. 2.
Primer binding sites in the S. pneumoniae pbp2B gene. P5 and P6 represent species-specific primers. R1 to R4 represent the four resistance primers.
- Fig. 3.
Agarose gel electrophoresis of PCR-amplified DNA fragments of the pbp2B gene from S. pneumoniae. Lane M, molecular size marker (in base pairs). Lane 1, negative control; lane 2, penicillin-susceptible S. pneumoniae. Primer combinations are as follows: R1 + P5 + P6 (lane 3), R3 + P5 + P6 (lane 4), R1 + R3 + P5 + P6 (lane 5), R2 + P5 + P6 (lane 6), R4 + P5 + P6 (lane 7), and R2 + R4 + P5 + P6 (band C is poorly visible) (lane 8). (A) A 682-bp species-specific product arising from amplification with primers P5 and P6. (B) A 328- to 334-bp products arising from amplification with primers R1 to R3 and P6. (C) A 214-bp product arising from amplification with primers R4 and P6. (D) Amplification products produced as a result of annealing between a resistance product(s) and the 682-bp product and which are subsequently extended by Taq DNA polymerase to produce a larger product (±900 to 1,000 bp).
Tables
- Table 1.
Properties of pneumococcal isolatesa
Isolate Hospital Specimen Serotype Yr of isolation Penicillin MIC (μg/ml) 69602 RXH T/Asp 6 1987 2 50800 RXH B/C 6 1990 2 45525 BH B/C 14 1992 2 47937 RXH Spt 19 1992 0.125 47921 RXH Spt 14 1992 2 47926 RXH E/S 6 1992 0.125 14309 RXH E/S 14 1987 0.03 24984 RXH E/S 23 1990 2 20396 RXH B/C 6 1996 0.25 20482 BH B/C 19 1996 0.125 20713 BH B/C 23 1996 2 20402 RXH B/C 6 1996 0.25 20685 NJH B/C 14 1996 0.125 12569 BH B/C 23 1991 2 22453 BH CSF 14 1989 4 85697 BH B/C 19 1988 2 48478 BH CSF 19 1989 4 4916 TH G/juice 23 1988 2 17283 MCT Spt 14 1987 1 65372 TH G/juice 19 1987 2 23252 BH B/C 1 1996 0.03 23253 BH B/C 1 1996 0.03 23255 BH B/C 1 1996 0.03 23254 BH B/C 1 1996 0.03 23241 HH B/C 10 1996 0.03 23312 BBH E/S 19 1996 0.125 23474 NJH B/C 15 1996 0.03 23475 NJH B/C 12 1996 0.03 23380 NJH B/C 5 1996 0.03 23328 BH B/C 3 1996 0.03 9833 Ermelo B/C 19 1995 4 8303 VD Spt 23 1995 4 10036 BH CSF 23 1995 0.5 ↵a Abbreviations: B/C, blood culture; T/Asp, tracheal aspirate; G/juice, gastric juice; E/S, ear swab; Spt, sputum; BH, Baragwanath Hospital; HH, Hillbrow Hospital; NJH, New Johannesburg Hospital; MCT, Medical School Observatory, Cape Town; BBH, Boksburg Benoni Hospital; VD, Van Drimmelen Laboratories; RXH, Red Cross Hospital; TH, Tshepong Hospital.
- Table 2.
Sequences of oligonucleotide primers
Primera Sequence (5′→3′) Position in pbp2B geneb Product length (bp) following PCR with downstream primer P6 R1 GCCTTTTCTAGGCCAATGCCGATTAC 697–722 331 R2 GCCTACGATTCATTCCCGATT 700–720 328 R3 AAATTGGCATATGGATCTTTTCCT 694–717 334 R4 GTTTTAACTAACAATTTAGAATCC 814–837 214 P5 CTGACCATTGATTTGGCTTTCCAA 346–369 682 P6 TTTGCAATAGTTGCTACATACTG 1006–1028
