Skip to main content
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems
  • Log in
  • My alerts
  • My Cart

Main menu

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About JCM
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems

User menu

  • Log in
  • My alerts
  • My Cart

Search

  • Advanced search
Journal of Clinical Microbiology
publisher-logosite-logo

Advanced Search

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About JCM
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
Mycology

Microsatellite Markers for Typing Aspergillus fumigatus Isolates

Emmanuelle Bart-Delabesse, Jean-François Humbert, Éric Delabesse, Stéphane Bretagne
Emmanuelle Bart-Delabesse
Laboratoire de Parasitologie-Mycologie, Hôpital Henri Mondor, Créteil,
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Jean-François Humbert
Institut National de Recherche Agronomique, Station d’Hydrobiologie Lacustre, Thonon-les-Bains,and
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Éric Delabesse
Laboratoire d’Hématologie, CNRS URA 1461, Hôpital Necker, Paris, France
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Stéphane Bretagne
Laboratoire de Parasitologie-Mycologie, Hôpital Henri Mondor, Créteil,
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
DOI: 10.1128/JCM.36.9.2413-2418.1998
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Article Figures & Data

Figures

  • Tables
  • Fig. 1.
    • Open in new tab
    • Download powerpoint
    Fig. 1.

    GeneScan analysis of PCR profiles obtained with two independent isolates (isolates A560 and A422). PCRs were performed with a 6-FAM-labeled primer (loci A, B, and C) or a HEX-labeled primer (locus D), and the PCR products for each microsatellite locus (A, B, C, and D) were run in an acrylamide-urea gel. Bands produced fluorescent peaks, and their molecular sizes were automatically determined by comparison to the TAMRA-labeled GeneScan internal size standards loaded in each well (data not shown). The numbers refer to the sizes (in base pairs) of the PCR products by considering the fluorescent peak with the maximum height.

  • Fig. 2.
    • Open in new tab
    • Download powerpoint
    Fig. 2.

    Allele size distributions of A. fumigatus isolates at microsatellite loci A (A), B (B), C (C), and D (D) upon analysis of 50 environmental isolates (solid bars) and 52 clinical isolates including 2 reference strains (striped bars).

  • Fig. 3.
    • Open in new tab
    • Download powerpoint
    Fig. 3.

    Correspondence analysis performed for all alleles showing the dispersion observed for the 102 A. fumigatus isolates. The projection in the plane defined by the two most informative axes is shown. Squares, environmental isolates; circles, clinical isolates; empty symbols, unique profiles; shaded symbols, profiles shared by two or more isolates. The two ellipses contain 90% of the individuals of each subgroup (dotted line for patient isolates; continuous line for environmental isolates). The centers of the ellipses are indicated, with a black circle for the patient isolate ellipse and a black square for the environmental isolate ellipse.

Tables

  • Figures
  • Table 1.

    Features of the four polymorphic microsatellite sequences of A. fumigatus upon analysis of 100 isolates and 2 reference strains

    MicrosatellitePrimer sequences (5′ to 3′)Microsatellite sequencesaLength range of PCR products (bp)Range of no. of repeatsTotal no. of alleles
    AGCCTACGATGACCGAAATGA(CA)9(GA)25108–15816–4112
    CTGTTTTGAGAAGCGGATGG
    BTTGCCATCGCTTGTCATAGA(CA)2C(CA)23102–1349–2511
    GCAGGTGGTTCAATAGGACAG
    CCGAAGCTCTCCCCTGCAAATC(CA)8165–1837–1610
    GATGCCGCTGGTGGTGTTGT
    DAGGGATACGGCTACGGACAA(CA)2176–1347–3623
    AAAGCGTCTGTCAGCGTGTCT
    • ↵a Based on the original DNA sequences of strain IP 2279.94.

  • Table 2.

    Discriminatory power of microsatellite markers for the 100 A. fumigatus isolates and the 2 reference strains tested

    Marker association(s)No. of typesNo. of types represented by a single isolateDiscriminatory power
    A1240.835
    B1110.793
    C1020.869
    D2340.948
    A + C31140.935
    B + C33160.944
    A + B35170.950
    A + D52260.981
    C + D55300.980
    B + D60360.986
    A + B + C49300.968
    A + C + D67450.987
    A + B + D73520.992
    B + C + D77580.992
    A + B + C + D80640.994
PreviousNext
Back to top
Download PDF
Citation Tools
Microsatellite Markers for Typing Aspergillus fumigatus Isolates
Emmanuelle Bart-Delabesse, Jean-François Humbert, Éric Delabesse, Stéphane Bretagne
Journal of Clinical Microbiology Sep 1998, 36 (9) 2413-2418; DOI: 10.1128/JCM.36.9.2413-2418.1998

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Print

Alerts
Sign In to Email Alerts with your Email Address
Email

Thank you for sharing this Journal of Clinical Microbiology article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Microsatellite Markers for Typing Aspergillus fumigatus Isolates
(Your Name) has forwarded a page to you from Journal of Clinical Microbiology
(Your Name) thought you would be interested in this article in Journal of Clinical Microbiology.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
Microsatellite Markers for Typing Aspergillus fumigatus Isolates
Emmanuelle Bart-Delabesse, Jean-François Humbert, Éric Delabesse, Stéphane Bretagne
Journal of Clinical Microbiology Sep 1998, 36 (9) 2413-2418; DOI: 10.1128/JCM.36.9.2413-2418.1998
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Top
  • Article
    • ABSTRACT
    • MATERIALS AND METHODS
    • RESULTS
    • DISCUSSION
    • ACKNOWLEDGMENTS
    • FOOTNOTES
    • REFERENCES
  • Figures & Data
  • Info & Metrics
  • PDF

KEYWORDS

Aspergillus fumigatus
Dinucleotide Repeats
Microsatellite Repeats

Related Articles

Cited By...

About

  • About JCM
  • Editor in Chief
  • Board of Editors
  • Editor Conflicts of Interest
  • For Reviewers
  • For the Media
  • For Librarians
  • For Advertisers
  • Alerts
  • RSS
  • FAQ
  • Permissions
  • Journal Announcements

Authors

  • ASM Author Center
  • Submit a Manuscript
  • Article Types
  • Resources for Clinical Microbiologists
  • Ethics
  • Contact Us

Follow #JClinMicro

@ASMicrobiology

       

ASM Journals

ASM journals are the most prominent publications in the field, delivering up-to-date and authoritative coverage of both basic and clinical microbiology.

About ASM | Contact Us | Press Room

 

ASM is a member of

Scientific Society Publisher Alliance

 

American Society for Microbiology
1752 N St. NW
Washington, DC 20036
Phone: (202) 737-3600

 

Copyright © 2021 American Society for Microbiology | Privacy Policy | Website feedback

Print ISSN: 0095-1137; Online ISSN: 1098-660X