Article Figures & Data
Figures
- Fig. 1.
GeneScan analysis of PCR profiles obtained with two independent isolates (isolates A560 and A422). PCRs were performed with a 6-FAM-labeled primer (loci A, B, and C) or a HEX-labeled primer (locus D), and the PCR products for each microsatellite locus (A, B, C, and D) were run in an acrylamide-urea gel. Bands produced fluorescent peaks, and their molecular sizes were automatically determined by comparison to the TAMRA-labeled GeneScan internal size standards loaded in each well (data not shown). The numbers refer to the sizes (in base pairs) of the PCR products by considering the fluorescent peak with the maximum height.
- Fig. 2.
Allele size distributions of A. fumigatus isolates at microsatellite loci A (A), B (B), C (C), and D (D) upon analysis of 50 environmental isolates (solid bars) and 52 clinical isolates including 2 reference strains (striped bars).
- Fig. 3.
Correspondence analysis performed for all alleles showing the dispersion observed for the 102 A. fumigatus isolates. The projection in the plane defined by the two most informative axes is shown. Squares, environmental isolates; circles, clinical isolates; empty symbols, unique profiles; shaded symbols, profiles shared by two or more isolates. The two ellipses contain 90% of the individuals of each subgroup (dotted line for patient isolates; continuous line for environmental isolates). The centers of the ellipses are indicated, with a black circle for the patient isolate ellipse and a black square for the environmental isolate ellipse.
Tables
- Table 1.
Features of the four polymorphic microsatellite sequences of A. fumigatus upon analysis of 100 isolates and 2 reference strains
Microsatellite Primer sequences (5′ to 3′) Microsatellite sequencesa Length range of PCR products (bp) Range of no. of repeats Total no. of alleles A GCCTACGATGACCGAAATGA (CA)9(GA)25 108–158 16–41 12 CTGTTTTGAGAAGCGGATGG B TTGCCATCGCTTGTCATAGA (CA)2C(CA)23 102–134 9–25 11 GCAGGTGGTTCAATAGGACAG C CGAAGCTCTCCCCTGCAAATC (CA)8 165–183 7–16 10 GATGCCGCTGGTGGTGTTGT D AGGGATACGGCTACGGACAA (CA)21 76–134 7–36 23 AAAGCGTCTGTCAGCGTGTCT ↵a Based on the original DNA sequences of strain IP 2279.94.
- Table 2.
Discriminatory power of microsatellite markers for the 100 A. fumigatus isolates and the 2 reference strains tested
Marker association(s) No. of types No. of types represented by a single isolate Discriminatory power A 12 4 0.835 B 11 1 0.793 C 10 2 0.869 D 23 4 0.948 A + C 31 14 0.935 B + C 33 16 0.944 A + B 35 17 0.950 A + D 52 26 0.981 C + D 55 30 0.980 B + D 60 36 0.986 A + B + C 49 30 0.968 A + C + D 67 45 0.987 A + B + D 73 52 0.992 B + C + D 77 58 0.992 A + B + C + D 80 64 0.994
