Recognition of Two Novel Phenons of the GenusAcinetobacter among Non-Glucose-Acidifying Isolates from Human Specimens

Isolates.In the period from 1991 to 1999, a total of 700 isolates of the genus Acinetobacter were received by the National Institute of Public Health (NIPH) from different diagnostic laboratories in the Czech Republic. The isolates were recovered from a variety of specimens from patients in hospitals or general practice and represented different levels of clinical significance, ranging from mere colonization to life-threatening infections. The majority of these isolates were sent to the NIPH for reasons of genus or species identification, epidemiological typing, or antibiotic susceptibility determination. All isolates had the properties of the genusAcinetobacter (21); i.e., they were gram-negative, strictly aerobic, oxidase-negative, nonmotile coccobacilli and were positive in the transformation assay of Juni (20). In total, 549 out of 700 isolates were allocated to the ACB complex by phenotypic methods (6) combined with computer-assisted identification (14). Four additional isolates were allocated to the ACB complex by ARDRA (10) and ribotyping (13). The remaining 147 isolates could not be identified as belonging to the ACB complex and were further investigated in the present study. Ninety-seven of these isolates were from outpatients or were obtained in general practice, 38 were from hospitalized patients, and 12 were from persons with unknown outpatient or inpatient status. These non-ACB complex isolates were recovered from nasal or throat swabs (n = 33), vaginal or cervical swabs (n = 21), urine (n = 20), blood (n = 16), wound swabs (n = 14), ear swabs (n = 13), eye swabs (n = 12), feces (n = 4), pus (n = 3), intravenous catheters (n = 2), and other specimens (n = 9).

Phenotypic characterization.The isolates were characterized using the tests of Bouvet and Grimont (6) and Gerner-Smidt et al. (14), with some minor modifications. In short, all tests were done at 30°C and recorded after 2 days unless indicated otherwise. Aerobic acid production from glucose was tested in Hugh and Leifson's agar medium (Difco) supplemented with 1% (wt/vol)d-glucose. The gelatinase test was performed on Trypticasein agar containing 4% (wt/vol) gelatin; Frazier reagent (15% [wt/vol] HgCl₂ in 20% [vol/vol] HCl) was used for the detection of gelatin hydrolysis. Hemolysis was tested on 5% sheep blood agar plates. Utilization of dl-lactate,dl-4-aminobutyrate, trans-aconitate, glutarate,l-aspartate, azelate, β-alanine, l-histidine,d-malate, malonate, histamine, l-phenylalanine, and phenylacetate was tested in tubes containing the defined fluid medium of Cruze et al. (9) supplemented with 0.1% (wt/vol) carbon (C) source. Each tube was inoculated with a drop of cell suspension of standardized turbidity (5 · 10⁷ to 1 · 10⁸ CFU/ml) prepared in saline from an overnight culture. Utilization of citrate was tested on Simmons citrate agar (Difco) and recorded after 6 days of incubation, while growth on the other C sources was evaluated after 2 and 6 days. Growth tests at 37, 41, and 44°C were performed in brain heart infusion broth (Difco) inoculated as described for the C source utilization tests.

Numerical probabilistic identification.The principles of probabilistic identification have been explained in detail by Priest and Williams (23). Briefly, by this method the likelihood that an unknown strain belongs to a given taxon is calculated. This likelihood is defined as the probability of obtaining the observed test results with a strain of this taxon. There are several options of using likelihoods for identification decisions. In the present study, computer-assisted probabilistic identification was performed as done by Gerner-Smidt et al. (14) who used the identification score (22)—often referred to as Willcox probability—and modal likelihood fraction (11) as identification parameters. Phenotypic data of each isolate were tested against two probability matrices represented by the computer-stored data tables in which the responses of each taxon to each test was recorded as a probability figure for a positive result. The first matrix (called the matrix of Bouvet and Grimont in this study) was derived from the data of Bouvet and Grimont (5) for genomic species 1 to 12 and from the data of Bouvet and Jeanjean (7) for genomic species 13BJ to 17BJ. This compiled matrix was also published by Grimont and Bouvet (15). The second matrix was adapted from that in the paper of Gerner-Smidt et al. (14) and included data for genomic species 1 to 12 and 13TU to 15TU described by Tjernberg and Ursing (26). Both matrices comprised all phenotypic tests listed above (except for hemolysis and phenylacetate, which were absent in the matrix of Bouvet and Grimont and the matrix of Gerner-Smidt et al., respectively), while the lower and upper limits of the reaction probabilities were set at 0.01 and 0.99, respectively. This was justified by the assumption of an error rate of 1% for any test result. The identification coefficients were determined as follows. First, the likelihood that a tested isolate belonged to each of the genomic species of a given matrix was calculated in turn by multiplication of the probabilities for the individual test results. The identification score (IS) was then determined by dividing this likelihood for a given genomic species by the sum of likelihoods for all genomic species of the matrix, while the modal likelihood fraction was calculated as the likelihood for a given genomic species divided by the maximum likelihood possible for that genomic species with the given tests. All the calculations were performed by using the software package BACTID, which was developed by J. Schindler, Jr., and J. Schindler (NIPH) and is available on request. An isolate was accepted as identified by a given probability matrix if the IS was ≥0.95 and modal likelihood fraction was ≥0.0001 (14).

ARDRA.The method was carried out as described (10, 25) with minor modifications. Briefly, isolates were grown overnight on Mueller-Hilton agar (Oxoid) at 30°C. A 1-μl loopful of colony growth was suspended in 20 μl of 0.05 M NaOH–0.25% (wt/vol) sodium dodecyl sulfate solution and heated at 98°C for 15 min. The suspension was diluted to a 200-μl final volume, agitated thoroughly, and centrifuged briefly. Aliquots of 1 μl of supernatant were used for amplification by PCR. The reaction mixture contained a 0.2 mM concentration of each nucleoside triphosphate a 0.2 μM concentration of each primer, 1.5 mM MgCl₂, 10 mM Tris-HCl, 50 mM KCl, and 0.5 U ofTaq polymerase (Takara Shuzo Co., Shiga, Japan). The sequences of the primers were 5′TGGCTCAGATTGAACGCTGGCGGC3′ (5′ end of the 16S rRNA gene) and 5′TACCTTGTTACGACTTCACCCCA3′ (3′ end of the 16S rRNA gene). Amplification was performed under the following conditions: initial denaturation for 6 min at 94°C; 35 cycles at 94°C for 45 s, at 60°C for 45 s, and at 72°C for 1 min; followed by 7 min at 72°C. Fractions of the amplimers were digested with the respective restriction enzymes Hin6I (a CfoI isoschizomer),AluI, MboI, RsaI, MspI (Fermentas, Vilnius, Lithuania), BfaI, or BsmAI (New England Biolabs, Beverly, Mass.). Restriction fragments were resolved by horizontal electrophoresis in 3% Metaphor agarose (FMC BioProducts, Rockland, Maine). ARDRA profiles, defined as a combination of the restriction patterns obtained with the respective enzymes, were interpreted according to the scheme of Dijkshoorn et al. (10), which is a revised and extended version of the scheme of Vannechoutte et al. (27). Additional CfoI andAluI patterns described for A. johnsonii by Seifert et al. (25) were also taken into account. As a rule, the isolates were first investigated with restriction enzymesHin6I (a CfoI isoschizomer), AluI, andMboI. Analysis by other enzymes was carried out only if the combination of patterns obtained by these enzymes was not unique for a particular genomic species or if there was disagreement between the ARDRA results and phenotypic identification.