Species-Specific Identification of Human Adenoviruses by a Multiplex PCR Assay

DOI: 10.1128/JCM.38.11.4114-4120.2000

Article Figures & Data

Open in new tab
Download powerpoint
Fig. 1.
Ethidium bromide-stained agarose gel showing PCR products from five different combinations of Ad species-specific primers. Lanes, from left to right:, respectively: M, molecular weight marker III (Boehringer Mannheim); species A-F, species A to F; A-D, F, species A, B, C, D, and F; B, D, E, species B, D, and E; B, C, E, species B, C, and E; B, C, D, species B, C, and D; Neg, template-free negative control. Numbers on the left are in base pairs.
Open in new tab
Download powerpoint
Fig. 2.
Ethidium bromide-stained agarose gel showing PCR products of 49 Ad prototype strains. Lanes, from left to right, respectively: M, molecular weight marker III (Boehringer Mannheim); P, pooled control DNAs of representative Ad serotypes of species A to F; 1 to 49, individual Ad serotypes; N, pooled control DNA without indicated Ad species. Numbers on the left are in base pairs.
Open in new tab
Download powerpoint
Fig. 3.
Ethidium bromide-stained agarose gel showing PCR products of the hexon (A) and fiber (B) multiplex assays. Lanes: M, molecular weight marker VI (Boehringer Mannheim); 1, isolate 98034069; 2, V-2064A; 3, 99018072; 4, V-2181; 5, V-2079A; 6, V-2167A; 7, RU-8176; 8, prototype Ad3; 9, Ad7; 10, Ad16; 11, Ad21; 12, Ad11; 13 Ad14; 14, Ad34; 15, Ad35; N, negative control. Both assays were performed with the same Ad DNA extracts, and identical results were obtained in two separate amplification reactions. Numbers on the left are in base pairs.

Table 1.

Oligonucleotide primers for PCR amplification of adenovirus species

Species	Primer	Polarity	Gene	Gene region	Position (nt no.)^a	Sequence (5′→3′)	Amplicon size (bp)^b
A to F	Ad1	+	Hexon		1834–1853	TTCCCCATGGCICAYAACAC	482
	Ad2	−			2315–2296	CCCTGGTAKCCRATRTTGTA
A	AdA1	+	Fiber	Tail	29392–29414	GCTGAAGAAMCWGAAGAAAATGA	1444–1537
	AdA2	−		Knob	30928–30908	CRTTTGGTCTAGGGTAAGCAC
B	AdB1	+	Fiber	Tail	4573–4595	TSTACCCYTATGAAGATGAAAGC	670–772
	AdB2	−		Knob	5242–5220	GGATAAGCTGTAGTRCTKGGCAT
C	AdC1	+	Fiber	Flank	333–354	TATTCAGCATCACCTCCTTTCC	1988–2000
	AdC2	−		Flank	2320–2301	AAGCTATGTGGTGGTGGGGC
D	AdD1	+	Fiber	Flank	5–25	GATGTCAAATTCCTGGTCCAC	1205–1221
	AdD2	−		Flank	1219–1198	TACCCGTGCTGGTGTAAAAATC
E	AdE1	+	Fiber	Tail	48–67	TCCCTACGATGCAGACAACG	967
	AdE2	−		Knob	1014–994	AGTGCCATCTATGCTATCTCC
F	AdF1	+	Fiber	Shaft	1734–1754	ACTTAATGCTGACACGGGCAC	541–586
	AdF2	−		Shaft	2274–2253	TAATGTTTGTGTTACTCCGCTC

↵a Nucleotide (nt) numbering for Ad group-specific primers based on published hexon gene sequence of Ad3 (41); nucleotide numbering for Ad species-specific primers based on published fiber gene sequences of Ad12 (49), Ad7 (26), Ad5 (7), Ad8 (39), Ad4 (17), and Ad40 (27).
↵b Predicted amplicon size range based on previously published nucleotide sequences of representative Ad serotypes for each species.

Table 2.

Comparison of types determined by species-specific multiplex PCR assays with types of 180 previously typed Ad field isolates

Original identification^a		No. of isolates tested	No. of isolates with the indicated result:
Original identification^a			Fiber multiplex PCR assay		Hexon multiplex PCR assay^b
Species	Serotype		Correct	Incorrect	Correct	Incorrect
A	12	2	2	0	2	0
	18	10	9	1	9	1
	31	8	7	1	7	1
	31 + 12	2	2	0	2	0
	Subtotal	22	20	2	20	2
B	3	4	4	0	4	0
	7, 7a	42	42	0	41	1
	11	3	3	0	1	2
	11/H14	1	1	0	1	0
	14	1	1	0	0	1
	16^c	11	11	0	11	0
	21/H21 + 35	2	2	0	0	2
	34/H11	1	1	0	1	0
	34	2	2	0	2	0
	35	2	2	0	1	1
	Subtotal	69	69	0	62	7
C	1	8	7	1	7	1
	2	10	10	0	10	0
	5	4	4	0	4	0
	6	5	5	0	5	0
	Subtotal	27	26	1	26	1
D	8	2	2	0	2	0
	9	1	1	0	1	0
	13	1	1	0	1	0
	15/H29	1	1	0	1	0
	17	1	1	0	1	0
	19	9	9	0	9	0
	22	1	1	0	1	0
	23	1	1	0	1	0
	28	1	1	0	1	0
	29	1	1	0	1	0
	30	1	1	0	1	0
	32/H27	1	1	0	1	0
	36	1	1	0	1	0
	37	2	2	0	2	0
	38	1	1	0	1	0
	39	1	0	1	0	1
	42	1	1	0	1	0
	43	1	1	0	1	0
	44/H13	1	1	0	1	0
	45	1	1	0	1	0
	46/H13	1	1	0	1	0
	47	1	1	0	1	0
	Subtotal	32	31	1	31	1
E	4	12	12	0	12	0
F	40	6	3	3	3	3
	41	4	4	0	4	0
	40 or 41	8	8	0	8	0
	Subtotal	18	15	3	15	3
Total		180	173	7	166	14

↵a Original identification of Ad isolates by hemagglutination inhibition (23) and/or neutralization (21) assay. Eight Ad40/41 isolates originally identified by commercial Ad40/41 enzyme immunoassay only.
↵b Ad species-specific hexon multiplex PCR procedure performed as described by Pring-Åkerblom et al. (42).
↵c Six of 11 Ad16 field isolates were later identified as Ad3 on retesting by neutralization assay.

Table 3.

Confirmation of results for Ad isolates with discrepant results by species-specific multiplex PCR assays

Isolate	Date collected (mo/day/yr)	Location	Original identification^a		Multiplex PCR assays^b		Repeat identification^c
Isolate	Date collected (mo/day/yr)	Location	Species	Serotype	Fiber	Hexon	Species	Serotype
V-1707	5/3/84	Alabama	A	Ad18	C	C	C	Ad2
V-2362	8/16/91	New Mexico	A	Ad31	D	D	D	Ad36
99018072	ND^d	Brazil	B	Ad11	B	Neg	B	Ad11
V-2181	12/20/88	New York	B	Ad11	B	Neg	B	Ad11
98034069	X/X/95	Egypt	B	Ad14	B	Neg	B	Ad14
V-2167A	9/8/85	Tennessee	B	Ad21/H21 + 35	B	Neg	B	Ad21 + 35
RU-8176	2/24/77	Tennessee	B	Ad21/H21 + 35	B	Neg	B	Ad21 + 35
V-2079A	4/30/87	Canada	B	Ad35	B	Neg	B	Ad35
V-2064A	1/30/87	Colorado	B	Ad7	B	Neg	B	Ad7
V-2215	7/26/89	Pennsylvania	C	Ad1	D	D	D	Ad19
V-375-4	8/28/89	El Salvador	D	Ad39	A	A	A	Ad31
V-2158B	6/22/88	Maryland	F	Ad40	A	A	A	Ad31
V-1533-18	11/24/81	Arizona	F	Ad40	A	A	A	Ad31
V-2159A	6/29/88	Maryland	F	Ad40	D	D	D	Ad9

↵a Original identification of Ad isolates made by hemagglutination inhibition (23) and/or neutralization (21) assay.
↵b Ad species-specific hexon multiplex PCR procedure performed as described by Pring-Åkerblom et al. (42).
↵c Repeat identification of Ad isolates made by microneutralization assay with type-specific horse antisera.
↵d ND, not determined.