Article Figures & Data
Figures
- Fig. 1.
(Left panel) SDS-PAGE and Coomassie staining of H. ducreyi outer membrane proteins and purified recombinant proteins.H. ducreyi strain 35000 was grown under heme-limiting conditions to induce synthesis of HgbA and TdhA. Recombinant His-tagged proteins were purified from E. coli as described in the text. Lanes: OMP, H. ducreyi outer membrane proteins (30 μg); rHgbA, rTdhA, rD15, purified recombinant proteins (2 μg each). Note the larger sizes of the hexahistidine leader-containing recombinant proteins compared to their respective native proteins. (Right panel) Western blots of H. ducreyi outer membrane proteins and recombinant proteins. Blots A, B, and C were probed with affinity-purified antipeptide IgG to HgbA, TdhA, or D15, respectively. In blot A, only 5 μg of outer membrane protein was loaded to visualize the abundant HgbA protein. In blots B and C, 30 μg of outer membrane protein was loaded to visualize the less abundant TdhA and D15 proteins. Each lane of recombinant protein contained 200 to 400 ng of protein.
- Fig. 2.
Serum specimens from 40 patients with lesions positive for H. ducreyi by M-PCR (open circles) and 45 normal human sera (solid circles) were tested in rpEIA using rHgbA, rTdhA, and rD15 protein antigens. O.D., OD405. The cutoff value for each antigen was established by ROC analysis (data not shown).
- Fig. 3.
Correlation between adEIA and rpEIA. Forty M-PCR-positive (A) and 29 M-PCR-negative (B) specimens were subjected to adEIA or rpEIA.
Tables
- Table 1.
Bacterial strains and plasmids
Strain or plasmid Relevant genotype or phenotype Source Strains E. coli K-12 DH5αMCR recA gyrB Bethesda Research Laboratories BL21(DE3) pLysS F−ompT hsDs(rBmB−)gal dcm(DE3) pLysS (Cmr) Novagen Nova Blue (DE3) endA1 hsdR17(rK12 mK12) supE44 thi-1 recA1 gyrA96 relA1 lac [F′proA+B+lacIqZΔM15::Tn10(Tcr)](DE3) Novagen H. ducreyi 35000 Wild type Stanley Spinolaa Plasmids pET30a T7 expression vector; Kanr Novagen pUNCH 671 tdhA; in pET30a This work pUNCH 672 hgbA; in pET30a This work pUNCH 1235 D15; in pET30a This work pCRII PCR cloning vector; Kanr Ampr In vitrogen ↵a Indiana University. Originally obtained from William Schalla, Centers for Disease Control and Prevention.
- Table 2.
Primers used for PCR
Primer Sequencea Size of PCR product (bp) (length of protein product [amino acids])b Restriction site HgbA 5′ CCGGATCCGAAAGCAATATGCAAACA 2,868 (992) BamHI HgbA 3′ GCGGCCGCTTAGAAAGTGATCTCTGC NotI TdhA 5′ GATGGATCCGAGGATAATCCCAAAAAT 2,180 (780) BamHI TdhA 3′ GCGGCCGCGTCGTTTTATGAAGTCAA NotI D15 5′ GGATCCGAATTCGCACCATTTGTAGTAAAAGAT 2,361 (819) BamHI D15 3′ CAGTTGGCAGCACATTCTAATTCGAACGCCGGCG NotI ↵a H. ducreyi sequence is shown in boldface, and restriction sites are underlined.
↵b Each protein product includes an N-terminal hexahistidine leader encoded by the vector. The vector leader sequence is fused to the first mature amino acid of each H. ducreyiprotein, and all three proteins end with the native terminal phenylalanine. The vector leader adds 40, 40, and 42 amino acids to the mature protein sequences of H. ducreyi HgbA, TdhA, and D15, respectively.
- Table 3.
Prevalence of antibodies to H. ducreyi HgbA and D15 among South African and U.S. populations with different levels of risk for chancroid
Presence of antibody to: No. (%) of specimens positive or antibody in: High-risk South African populations U.S. populations HgbA D15 Hda(n = 40) Other GUDb(n = 29) Urethritis High risk (VDRL+) (n = 45) Medium risk (VDRL−) (n = 45) Low risk (healthy blood donors) (n = 45) HIV+(n = 66) HIV− (n = 60) + + 37 (93) 5 (17) 13 (20) 11 (19) 2 (4) 3 (7) 1 (2) + − 0 4 (14) 4 (6) 6 (10) 2 (4) 1 (2) 0 − + 3 (7) 2 (7) 3 (5) 4 (7) 8 (18) 1 (2) 0 − − 0 18 (62) 46 (70) 38 (64) 33 (73) 40 (89) 44 (98) - Table 4.
Mean OD values for antigen-specific rpEIA for serum specimens from South African and U.S. patient populations with different levels of risk for chancroid
Group Mean OD405 ± SD for: HgbA TdhA D15 South Africa Chancroid (n = 40) 0.61 ± 0.26 0.64 ± 0.24 0.51 ± 0.18 Other (n = 29) 0.34 ± 0.16 0.34 ± 0.16 0.27 ± 0.11 Urethritis HIV+ (n = 66) 0.27 ± 0.20 0.29 ± 0.17 0.25 ± 0.15 HIV− (n = 60) 0.28 ± 0.18 0.27 ± 0.14 0.24 ± 0.12 United States VDRL+ (n = 45) 0.20 ± 0.10 0.32 ± 0.18 0.25 ± 0.14 VDRL− (n = 45) 0.21 ± 0.19 0.23 ± 0.17 0.24 ± 0.20 Blood donors (n = 45) 0.19 ± 0.06 0.29 ± 0.09 0.17 ± 0.05
