Article Figures & Data
Figures
- Fig. 1.
Schematic diagram of pyrosequencing. The reaction mixture consists of single-stranded DNA with an annealed primer, DNA polymerase, ATP sulfurylase, luciferase, and apyrase. The four nucleotide bases are added to the mixture in a defined order, e.g., A, C, G, and T. If the added nucleotide forms a base pair (in this case, two Ts base pair to the template), the DNA polymerase incorporates the nucleotide and consequently pyrophosphate (PPi) is released. The released pyrophosphate is converted to ATP by ATP sulfurylase, and luciferase uses this ATP to generate detectable light. This light is proportional to the number of nucleotides incorporated and is detected in real time. The pyrosequencing raw data are displayed simultaneously, and in this example the sequence generated reads ATCTT. The height of the signal is proportional to the number of nucleotides incorporated. Excess quantities of the added nucleotide are degraded by apyrase. If the nucleotide does not form a base pair with the DNA template, it is not incorporated by the polymerase and no light is produced. Apyrase then rapidly degrades the nucleotide.
- Fig. 2.
Pyrosequencing the seven codons in the protease gene that are primarily involved in drug resistance. The sequences of these codons (underlined) and their surrounding nucleotides are displayed above the pyrosequencing data. A negative G frameshift (underlined) is observed after sequencing codon 48. Codons 82 and 84 were sequenced (in the reverse direction) using primer 10, and the complete sequence shows that readability is maintained over 33 nucleotides, i.e., codons 84 to 75 (indicated above the sequence). Ambiguous sequence data are in italics. Note that the peaks between the individual codons cannot be directly compared, as the raw data are not to scale.
- Fig. 3.
Pyrosequencing data on defined mixtures of wild-type (MN) and mutant clones. The wild-type clone has the sequence TTGTC, while the mutant has the sequence TCGTC. Arrows correspond to positions where different ratios of the two templates give rise to different signal levels. These peaks are proportional to the percentage of each clone present in the mixture.
- Fig. 4.
Pyrosequencing polymorphic positions in HIV-1 DNA populations derived from PBMC from treatment-naı̈ve HIV-1-infected patients. (A) Comparison of the expected pattern generated from a wild-type sequence with the observed pattern (using primer 1) reveals the presence of mixed variants in sample B. Detailed analysis of the observed pattern reveals that one A peak (arrow) is approximately 40% larger than the first A peak and that the subsequent G peak is 60% of a normal G peak. Therefore the sequence of codon 13 in sample B is RTA. Direct Sanger sequencing of the PCR product shows a 50% mixture of A and G at codon 13. (B) Comparison of the expected pattern generated from a wild-type sequence with the observed pattern (using primer 1) reveals the presence of mixed variants in sample F. Detailed analysis of the observed pattern reveals that the second T peak (arrow) is 50% larger than the first T peak and that the next C peak is 50% of a normal C. The sequence of codon 11 in sample F is therefore GTY. The next base is also ambiguous in that G and A peaks which are approximately 50% of normal G and A peaks appear. The sequence of codon 12 in sample F is therefore RCA. Direct Sanger sequencing of the PCR product shows approximately 50% mixtures of T and C and A and G at codons 11 and 12, respectively. The mixed bases follow the International Union of Biochemistry (IUB) code (R is A or G, and Y is T or C).
- Fig. 5.
Detection of a minor virus variant by pyrosequencing which is not detected by Sanger sequencing. (A) Pyrosequencing patterns observed with primer 4 on a wild-type sample and sample F. The pattern generated for the wild type was also expected for sample F. (B) Predicted pyrosequencing pattern of sample F if composed of mixed variants (75% wild type [CAT] and 25% mutant [TAT]). (C) Sanger sequencing on sample F. Clone 1, sequencing of a clone with the sequence CAT at codon 36; clone 2, sequencing of a clone with the sequence TAT at codon 36; PCR product, direct sequencing of the PCR product revealing the sequence CAT for codon 36 with no peak representing the minor T variant observed.
- Fig. 6.
Graphs showing changes in HIV RNA levels and treatment in four patients. Arrows indicate samples from time points 1 to 4 that were subjected to pyrosequencing; dotted and solid boxes indicate NRTI and PI treatments, respectively. Open boxes illustrate that the patients were receiving these drugs before and/or after this 2 1/2-year period. ZDV, zidovudine; ddI, didanosine; 3TC, lamivudine; d4T, stavudine. (A) HIV RNA levels in patient 2. Pyrosequencing data show the development of drug resistance at codons 10 and 46. The amino acids involved in drug resistance are shown beneath the DNA sequence, with the approximate proportions of mixed variants at time point 2 indicated. The mixed bases follow the IUB code (M is A or C; R is A or G). (B) HIV RNA levels in patients 1, 3 and 4.
Tables
- Table 1.
Pyrosequencing primers for the HIV-1 protease gene and the codons that each primer sequences
Primer Nucleotide sequence (5′–3′) Genomic locationa Sequencing direction Codons sequencedb Codons involved in drug resistancec 1 CCCTCARATCACTCTTTGGC 2275–2294 Forward 8–18 8, 10, 16 2 TACTGTATYATCWGCYCCTGT 2271–2251 Reverse 14–25 20, 23, 24 3 CTATTAGAYACAGGRGCWGA 2342–2361 Forward 30–35 30 4 TTTCCATYTYCCTGGYAAA 2404–2386 Reverse 32–36 32, 33, 36 5 AAACCTCCAATTCCCCCTAT 2433–2414 Reverse 37–46 45,46 6d TTRCCAGGAARATGGAIRCCAAA 2387–2409 Forward 46–57 46, 47, 48, 50, 52 7 ATAGGGGGAATTGGAGGTTT 2414–2433 Forward 54–60 54, 55, 57, 60 8 TTTATCAARGTAARACARTATGA 2432–2454 Forward 61–68 63 9 CAATTATGTTGACAGGTGTAGGTCC 2531–2507 Reverse 67–77 69, 71, 73, 75, 77 10 TGRGTCAACAIRTTTCTTCCA 2550–2530 Reverse 75–84 81,82, 84 11 TACACCTRYCAACRTAATTGG 2512–2532 Forward 87–94 88,90, 91 12 TTGGAAGAAAYITGWTGACYCA 2529–2550 Forward 93–99 97 ↵a Genetic location (in nucleotides) refers to the MN sequence (accession no. AF075719 ).
↵b Codons 1 to 7, 26 to 29, 85, and 86 were not sequenced with this set of primers.
↵c The seven codons primarily involved in resistance are in boldface.
↵d The G variant of primer 6 was designed as pyrosequencing failed in a viral DNA sample because of an A-C mismatch at the underlined A.
- Table 2.
Clinical data on patients 1 to 4
Parameter Data for patient: 1 2 3 4 Clinical data at start of HAART Sex Male Male Male Male Age (yrs) 42 46 34 30 Time since diagnosis of HIV-1 infection (mos) 76 108 37 12 Prior AIDS diagnosis No No No Yes CD4 cell count 100 100 100 170 Log plasma HIV-1 RNA copies/ml 5.7 5.7 4.2 4.6 Prior nucleoside analogue (NA) treatment (mos) 32 56 33 9 New NA (at least one) at start of HAART Yes No No No PI at start of HAART RTV IDV IDV IDV Clinical data at end of follow-up Length of follow-up after start of HAART (mos) 23 28 27 30 Time with no or partial HAART (days) 127 0 28 0 New AIDS-defining events or death No No No No CD4 cell count 370 330 280 150 Log plasma HIV-1 RNA copies/ml 4.3 4.6 4.5 4.8 - Table 3.
Development of drug resistance mutations in patients 1 to 4 over a 2 1/2-year period
Patient Amino acida (codon) at time point: PI implicatedb 1 2 3 4 1 Asp30 (GAT) Asp30 (GAT) Asn30 (AAT) 1°, NFV 2 Leu10 (CTC) Leu/Ile10 (MTC) Ile10(ATC) Ile10 (ATC) 2°, IDV-SQV Leu24 (TTA) Leu24 (TTA) Ile24 (ATA) Ile24(ATA) 2°, IDV Met46 (ATG) Met/Ile46(ATR) Ile46 (ATA) Ile46 (ATA) 1°, IDV; 2°, RTV Gly48 (GGG) Gly48 (GGG) Val48(GTG) Val48 (GTG) 1°, SQV Ala71 (GCT) Ala71 (GCT) Val71 (GTT) Val71(GTT) 2°, IDV-RTV-SQV Val77 (GTA) Val/Ile77(RTA) Ile77 (ATA) Ile77 (ATA) 2°, IDV-RTV-SQV Val82 (GTC) Val82 (GTC) Ala82(GCC) Ala82 (GCC) 1°, IDV-RTV; 2°, SQV Ile84 (ATA) Ile84 (ATA) Val84(GTA) Val84 (GTA) 1°, RTV; 2°, SQV 3 Leu/Ile10 (MTC) Ile10(ATC) Ile10 (ATC) Ile10 (ATC) 2°, IDV Met46 (ATG) Met46 (ATG) Ile46(ATA) Ile46 (ATA) 1°, IDV; 2°, RTV Gly73 (GGT) Gly73 (GGT) Ser73 (AGT) Ser73(AGT) 2°, IDV-SQV Leu90 (TTG) Leu90 (TTG) Met90 (ATG) Met90 (ATG) 1°, SQV 4 Leu90 (TTG) Leu90 (TTG) Leu90 (TTG) Met90(ATG) 1°, SQV
