Skip to main content
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems
  • Log in
  • My alerts
  • My Cart

Main menu

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About JCM
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems

User menu

  • Log in
  • My alerts
  • My Cart

Search

  • Advanced search
Journal of Clinical Microbiology
publisher-logosite-logo

Advanced Search

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About JCM
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
Bacteriology

Nomenclature of Major Antimicrobial-Resistant Clones of Streptococcus pneumoniae Defined by the Pneumococcal Molecular Epidemiology Network

L. McGee, L. McDougal, J. Zhou, B. G. Spratt, F. C. Tenover, R. George, R. Hakenbeck, W. Hryniewicz, J. C. Lefévre, A. Tomasz, K. P. Klugman
L. McGee
MRC/SAIMR/WITS Pneumococcal Diseases Research Unit, Johannesburg, South Africa;
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
L. McDougal
Nosocomial Pathogens Laboratory Branch, Centers for Disease Control and Prevention, Atlanta, Georgia 30333;
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
J. Zhou
Department of Infectious Disease Epidemiology, Imperial College School of Medicine, and
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
B. G. Spratt
Department of Infectious Disease Epidemiology, Imperial College School of Medicine, and
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
F. C. Tenover
Nosocomial Pathogens Laboratory Branch, Centers for Disease Control and Prevention, Atlanta, Georgia 30333;
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
R. George
Respiratory and Systemic Infection Laboratory, London, England;
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
R. Hakenbeck
University of Kaiserslautern, Kaiserslautern, Germany;
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
W. Hryniewicz
Sera and Vaccines Central Research Laboratory, Warsaw, Poland;
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
J. C. Lefévre
Laboratoire de Bactériologie, Toulouse, France; and
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
A. Tomasz
Rockefeller University, New York, New York 10021
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
K. P. Klugman
MRC/SAIMR/WITS Pneumococcal Diseases Research Unit, Johannesburg, South Africa;
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
DOI: 10.1128/JCM.39.7.2565-2571.2001
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

ABSTRACT

The emergence of disease caused by penicillin-resistant and multidrug-resistant pneumococci has become a global concern, necessitating the identification of the epidemiological spread of such strains. The Pneumococcal Molecular Epidemiology Network was established in 1997 under the auspices of the International Union of Microbiological Societies with the aim of characterizing, standardizing, naming, and classifying antimicrobial agent-resistant pneumococcal clones. Here we describe the nomenclature for 16 pneumococcal clones that have contributed to the increase in antimicrobial resistance worldwide. Guidelines for the recognition of these clones using molecular typing procedures (pulsed-field gel electrophoresis, BOX-PCR, and multilocus sequence typing) are presented, as are the penicillin-binding profiles and macrolide resistance determinants for the 16 clones. This network can serve as a prototype for the collaboration of scientists in identifying clones of important human pathogens and as a model for the development of other networks.

The emergence of penicillin-resistant and multidrug-resistant pneumococcal strains has become a global concern. Since the first description of pneumococci with decreased susceptibilities to penicillin in Australia (18) in the late 1960s, penicillin-resistant strains have been found in various parts of the world with increasing frequency. Resistance to non-β-lactam antibiotics such as chloramphenicol, tetracycline, erythromycin, clindamycin, rifampin, and trimethoprim-sulfamethoxazole also has been reported (2, 22) and often is associated with decreased susceptibility to penicillin (1). Penicillin-resistant pneumococci have been reported with particularly high frequencies in Spain (14, 15), South Africa (22), and Hungary (31) since the mid-1970s, in France (29), Iceland (52), and the United States (48) since the middle to late 1980s and early 1990s, and in the Far East during the 1990s (21, 53).

Although the first penicillin-resistant pneumococcus was identified in an adult (18), the first multidrug-resistant strains were found in children (20), and penicillin-resistant strains have been shown to be more common in children wherever penicillin resistance has been studied. Penicillin-resistant (MICs of ≥2 μg/ml) and multidrug-resistant pneumococci are known to be restricted worldwide to a few serogroups, namely, 23, 6, 19, and 9, and serotype 14, which are particularly associated with carriage and disease in children (10, 22).

The era of the global spread of penicillin-resistant pneumococci has seen the rapid development of DNA typing techniques for use in research and epidemiological investigations. Molecular studies have shown that the penicillin-resistant and multidrug-resistant pneumococcal populations are highly dynamic and that resistance is a combination of the spread of resistant clones, the acquisition and loss of resistance genes within those clonal lineages, and the spread of resistance genes to new lineages. Several techniques, including pulsed-field gel electrophoresis (PFGE) (28), BOX-PCR (24, 60), and, more recently, multilocus sequence typing (MLST) (13), have been used to determine the genetic relatedness of pneumococcal isolates. A search of the literature shows that extensive molecular typing studies from various regions of the world have identified a number of clones of antimicrobial-resistant pneumococci that have achieved significant geographic spread within individual countries and, in some cases, across international boundaries.

The Pneumococcal Molecular Epidemiology Network (PMEN) was established in 1997 under the auspices of the International Union of Microbiological Societies with the aim of standardizing the nomenclature and classification of resistant pneumococcal clones worldwide. Specific objectives of the network include the following: (i) international collaboration and training support between laboratories and institutions; (ii) increased knowledge of resistance and spread of pneumococci worldwide; (iii) standardization of nomenclature of national and international clones; (iv) identification of clones using PFGE, BOX-PCR, and MLST; (v) availability of reference isolates of each clone from the American Type Culture Collection (ATCC); and (vi) access to information through a website.

The nomenclature of 16 national and international antibiotic-resistant pneumococcal clones tested using PFGE, BOX-PCR, and MLST is described. Penicillin-binding protein (PBP) profiles and macrolide resistance determinants are also described.

MATERIALS AND METHODS

Bacterial strains.Representative isolates for each of the 16 S. pneumoniae clones were serotyped by the Quellung reaction, and MICs of penicillin, cefotaxime, erythromycin, clindamycin, chloramphenicol, tetracycline, and trimethoprim-sulfamethoxazole were determined according to National Committee for Clinical Laboratory Standards criteria (39). ATCC accession numbers for the 16 clones are given in Table1.

View this table:
  • View inline
  • View popup
Table 1.

Properties of 16 pneumococcal clonesa

DNA fingerprinting. (i) BOX-PCR.Chromosomal DNA was isolated by the method described by Ausubel et al. (3). DNA amplifications were performed with 50-μl volumes containing 4 mM MgCl2, 2 μM primer AR1 (CTACGGCAAGGCGACGCTGACG) (60), 150 μM each of the four deoxynucleoside triphosphates (Roche Diagnostics, Mannheim, Germany), 20 ng of genomic DNA, 1 U of Taq DNA polymerase (Advanced Biotechnologies, Epsom, United Kingdom), and 5 μl of 10× reaction buffer. The reaction mixture was overlaid with mineral oil and subjected to initial denaturation at 95°C for 5 min in a Perkin-Elmer Cetus thermal cycler. This step was followed by 30 cycles of 1 min at 90°C, 1 min at 52°C, and 2 min at 72° and a final extension at 72°C for 5 min. PCR products were run on a 2% ethidium bromide-containing agarose gel in Tris-acetate-EDTA buffer for 2 h at 120 V.

(ii) PFGE.Genomic DNA was prepared in situ in agarose blocks as described previously (28, 33) and was digested with SmaI (Life Technologies, Gaithersburg, Md.). The fragments were resolved by PFGE in 1% agarose (SeaKem GTG agarose; BioWhittaker Molecular Applications, Rockland, Maine) in 0.5× Tris-borate-EDTA buffer at 14°C and 6 V/cm in a CHEF-DR III system (Bio-Rad Laboratories, Hercules, Calif.). The parameters for block 1 were an initial pulse time of 1 s increased to 30 s over 17 h; those for block 2 were 5 s increased to 9 s over 6 h.

(iii) MLST.MLST was carried out as described previously (13). Briefly, internal fragments of the aroE,gdh, gki, recP, spi,xpt, and ddl genes were amplified by PCR from chromosomal DNA using the primer pairs described by Enright and Spratt (13). The amplified fragments were directly sequenced in each direction using the primers that were used for the initial amplification. The sequences at each of the seven loci were then compared with the sequences of all of the known alleles at those loci. Sequences that were identical to the sequence of a known allele were assigned the same allele number, whereas those that differed from the sequence of any known allele, even at a single nucleotide site, were assigned new allele numbers. The assignment of alleles at each locus was carried out using the software available at the pneumococcal MLST website (http://www.mlst.net ). The alleles at each of the seven loci define the allelic profile of each isolate as well as their sequence type. Allelic profiles are shown as a series of seven integers which correspond to the alleles at each of the loci, in the orderaroE, gdh, gki, recP,spi, xpt, and ddl. The relatedness between the isolates was represented as a dendrogram, constructed by the unweighted pair-group method with arithmetic averages, from the matrix of pairwise differences in the allelic profiles. The allelic profiles of the reference isolates of each clone are deposited in the database at the pneumococcal MLST website.

PBP analysis.The genes encoding PBP1A, PBP2B, and PBP2X were amplified using primers and conditions previously described (7). Purified DNA fragments were analyzed using the enzymes HinfI and MseI-DdeI for the PBP1A and PBP2X genes and HinfI and StyI for the PBP2B gene. The samples were electrophoresed at 120 V on a 2% agarose gel for 2 h and stained with ethidium bromide.

Macrolide resistance determinants.A multiplex PCR using previously published primers (55) was used to detect themefA and ermB genes in S. pneumoniae strains. Amplification reactions were performed with 50-μl volumes containing 1× reaction buffer; 5 mM MgCl2; 200 μM each dATP, dCTP, dGTP, and dTTP; 1 μM each primer; 1 U of Taq DNA polymerase; and 20 ng of DNA. Amplification was performed with a Perkin-Elmer Cetus DNA thermal cycler programmed for 1 cycle of denaturation at 95°C for 2 min; 30 cycles of denaturation at 95°C for 1 min, primer annealing at 56°C for 2 min, and extension at 72°C for 2 min; and 1 cycle of extension at 72°C for 10 min. Amplification products were run on 2% agarose gels and detected by staining with ethidium bromide.

RESULTS

Nomenclature of clones.The following criteria were established for inclusion of clones in the PMEN: (i) a clone must have a wide geographic distribution throughout a country or have spread internationally; (ii) a clone should be well established within a country over a number of years; (iii) a clone should be resistant to one or more antibiotics that are in wide clinical use; (iv) data on the clone need to be published or in press before ratification by the network; and (v) a representative isolate of the clone must be made available for confirmation by molecular typing that it differs from previously accepted clones, and permission must be granted to deposit it into the ATCC.

The system use for the naming of clones is as follows: countryfirst identified serotype-sequential numbering in network-subsequent described serotype. For example, in Spain23F-1, Spain is the country in which the clone was first identified (based on publication), 23F is the serotype of the clone first identified, and 1 is the clone number.

In large countries, such as the United States and Russia, the naming of clones could be considered by province or state if the clone is predominantly found in one region of the country, for example, Tennessee23F-4.

Several publications have shown that members of a single clone may express different capsular polysaccharides. In the case of capsular switching, the nomenclature is, e.g., as follows: in Spain23F-1-19F, 19F indicates a serotype 19F variant of the Spain23F-1 clone.

DNA typing.Representative isolates of the 16 clones are shown in Table 1; references indicate the first published reports of the clones. Molecular typing of isolates of each of the 16 clones by BOX-PCR (Fig. 1), PFGE (Fig.2), and MLST (Table2; Fig. 3) determined that their genotypes were sufficiently different to distinguish them as distinct clones.

Fig. 1.
  • Open in new tab
  • Download powerpoint
Fig. 1.

BOX-PCR fingerprint patterns of representative isolates of the 16 clones described in Table 1. CSR, Czech Republic. Lanes M, marker VI (Roche Diagnostics).

Fig. 2.
  • Open in new tab
  • Download powerpoint
Fig. 2.

PFGE fingerprint patterns of SmaI restriction digests of representative isolates of the 16 clones described in Table 1.

View this table:
  • View inline
  • View popup
Table 2.

MLST allelic profiles, PBP profiles, and macrolide resistance determinants for 16 clonesa

Fig. 3.
  • Open in new tab
  • Download powerpoint
Fig. 3.

Dendrogram constructed from MLST data showing the genetic relatedness of the 16 pneumococcal clones described in Table1.

Resistance determinants.PBP fingerprinting results for the PBP1A, PBP2B, and PBP2X genes are shown in Table 2. Twelve patterns were identified for the PBP1A and PBP2X genes, and 11 were identified for the PBP2B gene. The Spain23F-1 and Spain9V-3 clones shared identical PBP profiles, as did the two clones from the Czech Republic (CSR14-10 and CSR19A-11).

The macrolide resistance determinants are shown in Table 2. We identified the ermB gene in 6 of the 16 strains and themefA gene in 3. The Poland23F-16 clone, for which the erythromycin MIC was >8 μg/ml, harbored neither the ermB nor the mefA gene for macrolide resistance.

DISCUSSION

The global increase in highly penicillin-resistant and multidrug-resistant pneumococci appears, in large part, to result from the spread of individual highly resistant pneumococcal clones. This phenomenon has been particularly highlighted by the worldwide spread of the serotype 23F pneumococcal clone (Spain23F-1), first identified in Spain in the early 1980s (37) and resistant to penicillin, chloramphenicol, and tetracycline (and sometimes erythromycin). This successful clone has now been found in the United States (26, 37), South Africa (23), the United Kingdom (7), South America (5, 6, 12, 43), several other countries in Europe (29, 30, 42, 46, 48, 50, 58, 61), and the Far East (34, 47, 59). Serotype 19F (7), 14 (4), 19A (9), 9N (40), and 3 (40) and serogroup 6 (54) variants of this clone have also been reported in various regions of the world. Of these serotype variants of the Spain23F-1 clone, those expressing the serotype 19F capsule are the most commonly encountered. A recent study conducted in the United States showed that close to 40% of all highly penicillin-resistant pneumococci belong to this Spain23F-1 clone (10).

The penicillin-resistant serotype 9V clone (Spain9V-3), first identified in Spain (7) and France (29), has become widely disseminated throughout the world and has been identified in Italy (30), Sweden (35), Germany (42), the United States (10), the United Kingdom (7), South America (6, 12), and the Far East (34, 47). Serotype 14 (11, 36) and 9A (46) and serogroup 19 (10, 43) variants of this clone have been reported in numerous countries. The serotype 14 variants of the Spain9V-3 clone are the most commonly encountered.

The overwhelming majority of S. pneumoniae isolates for which MICs were about 1.0 μg/ml or higher (107 of 119 isolates, or 89.9%, collected during surveillance from 1996 through 1998) and colonizing the nasopharynges of children attending day care centers in Lisbon, Portugal, belonged to serotype variants of the Spain23F-1 and Spain9V-3 clones (44, 45).

The multidrug-resistant serotype 6B clone (Spain6B-2), recovered in Spain for over a decade, has become the dominant pneumococcus isolated from children in Iceland (52), where it accounts for approximately 75% of multidrug-resistant pneumococci (25). It has also been identified in other countries in Europe (29, 42) and elsewhere, including the United Kingdom (52), the United States (62), and Taiwan (47). Interestingly, Vilhelmsson et al. (63) recently described the emergence of antibiotic-resistant variants of this 6B clone in Iceland which have lost one or more of the antibiotic resistance phenotypes and/or resistance genes, singly or in combination.

Studies from other countries that have a high incidence of antibiotic-resistant pneumococci have identified additional distinctive clones that have presumably emerged within these countries. An example is the serotype 23F pneumococci resistant to extended-spectrum cephalosporins and originally isolated in Tennessee in the United States (33). This clone (Tennessee23F-4), which probably evolved locally and is unrelated to the Spain23F-1 clone, is characterized by a mutation at position 550 in the pbp2Xgene which confers high-level cephalosporin resistance. Pneumococci belonging to a multidrug-resistant serotype 14 clone (Spain14-5) have been identified among isolates recovered from six Spanish hospitals between 1990 and 1994 (8). A clone of multidrug-resistant serotype 19A strains first identified in Hungary (Hungary19A-6) (31) has been described in the Czech Republic and Slovakia (16). A second, highly penicillin-resistant clone of serotype 19A (CSR19A-10) and a serotype 14 clone (CSR14-11) have also been described in Slovakia and the Czech Republic (16). An analysis of a wide geographic diversity of resistant pneumococcal isolates in South Africa has identified two clones of serogroup 19A, one intermediately resistant to penicillin (South Africa19A-7) and the other multiply resistant (South Africa19A-13) (51). In addition, a unique penicillin-resistant serotype 6B clone (South Africa6B-8) has emerged locally in South Africa (51). The widespread use of erythromycin may have led to the emergence of a serotype 14 clone (England14-9) resistant only to erythromycin in various parts of the United Kingdom (17). In Finland, pneumococcal strains resistant to multiple antibiotics have been characterized as belonging to a serogroup 6B clone (Finland6B-12) (48). Shi et al. (47) have recently used MLST to describe two antibiotic-resistant clones that have emerged in Taiwan, a serotype 19F clone (Taiwan19F-14) and a serotype 23F clone (Taiwan23F-15). The former clone has been recovered from several countries in the Far East and elsewhere (J. Zhou and B. G. Spratt, unpublished results). Penicillin resistance among pneumococcal isolates has rapidly emerged in Poland during the last decade. Although the pandemic Spain23F-1 and France9V-3 clones are present in that country, a novel serotype 23F clone (Poland23F-16) has clearly contributed to the increase in the prevalence of penicillin-resistant pneumococci nationwide (41).

A search of the literature indicates that the initial characterization of clones within a population of resistant pneumococci can be conveniently carried out using several molecular typing methods, including BOX-PCR (60), repetitive extragenic palindromic-PCR (62), multilocus enzyme electrophoresis (37), and PFGE (52). Most studies have analyzed penicillin-resistant isolates, and each of the above techniques can successfully identify clusters of closely related isolates within a population. However, determination of whether clones are novel or related to previously described clones is more problematic. Some of the clones are relatively old (e.g., 20 years), and substantial variations may have accumulated in the PFGE or BOX profiles of the descendents of the ancestral member of a clone. It can therefore be difficult to decide whether a resistant strain is sufficiently similar by PFGE or BOX-PCR analysis to be considered a member of a known clone or should be considered a distinct and previously unrecognized clone. MLST provides a less ambiguous and highly portable approach to global epidemiological studies by defining the genotypes of antibiotic-resistant isolates based on the alleles at each of seven housekeeping loci (13, 47, 64). MLST studies have shown that isolates of each of the Spain23F-1, Spain6B-2, Spain9V-3, and Spain14-5 clones typically have identical allelic profiles or differ from the typical profile at only one of the seven loci (64). MLST therefore assigns an isolate as a member of one of the resistant clones if it has the allelic profile of the reference isolate of that resistant clone or differs from it at a single locus. Isolates whose allelic profiles differ at three or more of the seven loci used in MLST can be regarded as distinct clones (13, 47, 64). Clearly, PFGE, BOX-PCR, and MLST results do correlate well, although the DNA fragment patterns used in PFGE and BOX-PCR are believed to diversify more rapidly than the allelic profiles used in MLST. Thus, PFGE provides increased levels of discrimination which may be useful for local epidemiological studies, whereas MLST provides a more rigorous way of assigning isolates to one of the major clones.

It should be remembered that similarity of genotype does not necessarily imply that two resistant isolates are members of the same clone. Penicillin resistance has emerged predominantly in a small number of serotypes, and although isolates of the same serotype are often only distantly related in terms of overall genotype (13), most isolates of a few serotypes appear to have very similar genotypes (13, 57). For example, almost all isolates of serotype 9V appear to be similar in genotype, and two resistant clones of this serotype that emerged independently will inevitably appear to be closely related (64). Rigorous assignment of penicillin-resistant isolates to the same clone should therefore also involve an analysis of their PBP1A, PBP2B, and PBP2X genes. PBP analysis of the 16 clones showed that the Spain23F-1 and Spain9V-3 clones harbored identical PBP1A, PBP2B, and PBP2X genes (1-1-1), as previously described by Coffey et al. (7). The presence of identical PBP genes (8-6-7) in the chromosomes of the two unrelated clones from the Czech Republic and Slovakia (CSR14-10 and CSR19A-11) suggests the horizontal transfer of these PBP genes.

Nine of the 16 clones were resistant to erythromycin, and 6 clones carried the ermB resistance determinant, which codes for target modification by 23S rRNA methylase (27). Three isolates showed the M phenotype (macrolide resistant but clindamycin and streptogramin B susceptible) and carried the mefAgene, which codes for an efflux mechanism (56).

In conclusion, the PMEN includes the molecular characterization and nomenclature of 16 important national and international antibiotic-resistant clones that have contributed to the rapid increase in resistance in pneumococci worldwide. The biological basis of the successful spread of these particular clones remains to be established.

ACKNOWLEDGMENT

The establishment and continued work of the network have been made possible by financial support from the ICSU.

FOOTNOTES

    • Received 12 February 2001.
    • Returned for modification 2 April 2001.
    • Accepted 22 April 2001.
  • Copyright © 2001 American Society for Microbiology

REFERENCES

  1. 1.↵
    1. Allen K. D.
    Penicillin-resistant pneumococci.J. Hosp. Infect.171991313
    OpenUrlCrossRefPubMedWeb of Science
  2. 2.↵
    1. Appelbaum P. C.
    Antimicrobial resistance in Streptococcus pneumoniae: an overview.Clin. Infect. Dis.1519927783
    OpenUrlCrossRefPubMedWeb of Science
  3. 3.↵
    1. Ausubel F. M.,
    2. Brent R.,
    3. Kingston R. E.,
    4. Moore D. D.,
    5. Seidman J. G.,
    6. Smith J. A.,
    7. Struhl K.
    Short protocols in molecular biology 1998 61 63 John Wiley & Sons, Inc. New York, N.Y
  4. 4.↵
    1. Barnes D. M.,
    2. Wittier S.,
    3. Gilligan P. H.,
    4. Soares S.,
    5. Tomasz A.,
    6. Henderson F. W.
    Transmission of multidrug-resistant serotype 23F Streptococcus pneumoniae in group day care: evidence suggesting capsular transformation of the resistant strain in vivo.J. Infect. Dis.1711995890896
    OpenUrlCrossRefPubMedWeb of Science
  5. 5.↵
    1. Camou T.,
    2. Hortal M.,
    3. Tomasz A.
    The apparent importation of penicillin-resistant capsular type 14 Spanish/French clone of Streptococcus pneumoniae into Uruguay in the early 1990s.Microb. Drug Resist.41998219224
    OpenUrlPubMed
  6. 6.↵
    1. Castañeda E.,
    2. Tomasz A.,
    3. Vela M. C. T.
    Penicillin-resistant Streptococcus pneumoniae in Colombia: presence of international epidemic clones.Microb. Drug Resist.41998233239
    OpenUrlPubMedWeb of Science
  7. 7.↵
    1. Coffey T. J.,
    2. Dowson C. G.,
    3. Daniels M.,
    4. Zhou J.,
    5. Martin C.,
    6. Spratt B. G.,
    7. Musser J. M.
    Horizontal transfer of multiple penicillin-binding protein genes, and capsular biosynthetic genes, in natural populations of Streptococcus pneumoniae.Mol. Microbiol.5199122552260
    OpenUrlCrossRefPubMedWeb of Science
  8. 8.↵
    1. Coffey T. J.,
    2. Berrón S.,
    3. Daniels M.,
    4. Garcia-Leoni E.,
    5. Cercenado E.,
    6. Bouza E.,
    7. Fenoll A.,
    8. Spratt B. G.
    Multiply antibiotic-resistant Streptococcus pneumoniae recovered from Spanish hospitals (1988–1994): novel major clones of serotypes 14, 19F and 15F.Microbiology142199627472757
    OpenUrlCrossRefPubMedWeb of Science
  9. 9.↵
    1. Coffey T. J.,
    2. Enright M. C.,
    3. Daniels M.,
    4. Wilkinson P.,
    5. Berrón S.,
    6. Fenoll A.,
    7. Spratt B. G.
    Serotype 19A variants of the Spanish serotype 23F multiresistant clone of Streptococcus pneumoniae.Microb. Drug Resist.419985155
    OpenUrlCrossRefPubMedWeb of Science
  10. 10.↵
    1. Corso A.,
    2. Severina E. P.,
    3. Petruk V. F.,
    4. Mauriz Y. R.,
    5. Tomasz A.
    Molecular characterization of penicillin-resistant Streptococcus pneumoniae isolates causing respiratory disease in the United States.Microb. Drug. Resist.41998325337
    OpenUrlCrossRefPubMedWeb of Science
  11. 11.↵
    1. Doit C.,
    2. Denamur E.,
    3. Picard B.,
    4. Geslin P.,
    5. Elion J.,
    6. Bingen E.
    Mechanisms of the spread of penicillin resistance in Streptococcus pneumoniae strains causing meningitis in children in France.J. Infect. Dis.1741996520528
    OpenUrlCrossRefPubMedWeb of Science
  12. 12.↵
    1. Echániz-Aviles M.,
    2. Carnalla-Barajas N.,
    3. Velàzquez-Meza M. E.,
    4. Soto-Noguerón A.,
    5. Espinoza-de los Monteros L. E.,
    6. Solórzano-Santos F.
    Capsular types of Streptococcus pneumoniae causing disease in children from Mexico City.Pediatr. Infect. Dis. J.141995907909
    OpenUrlPubMedWeb of Science
  13. 13.↵
    1. Enright M. C.,
    2. Spratt B. G.
    A multilocus sequence typing scheme for Streptococcus pneumoniae: identification of clones associated with serious invasive disease.Microbiology144199830493060
    OpenUrlCrossRefPubMedWeb of Science
  14. 14.↵
    1. Fenoll A.,
    2. Bourgon M.,
    3. Munoz R.,
    4. Vicioso D.,
    5. Casal J.
    Serotype distribution and antimicrobial resistance of Streptococcus pneumoniae isolates causing systemic infections in Spain, 1979–1989.Rev. Infect. Dis.1319915660
    OpenUrlCrossRefPubMedWeb of Science
  15. 15.↵
    1. Fenoll A.,
    2. Jado I.,
    3. Vicioso D.,
    4. Pérez A.,
    5. Casal J.
    Evolution of Streptococcus pneumoniae serotypes and antibiotic resistance in Spain: update (1990–1996).J. Clin. Microbiol.36199834473454
    OpenUrlFREE Full Text
  16. 16.↵
    1. Figueiredo A. M.,
    2. Austrian R.,
    3. Urbaskova P.,
    4. Teixeira L. A.,
    5. Tomasz A.
    Novel penicillin-resistant clones of Streptococcus pneumoniae in the Czech Republic and Slovakia.Microb. Drug Resist.119957178
    OpenUrlCrossRefPubMedWeb of Science
  17. 17.↵
    1. Hall L. M.,
    2. Whiley R. A.,
    3. Duke B.,
    4. George R. C.,
    5. Efstratiou A.
    Genetic relatedness within and between serotypes of Streptococcus pneumoniae from the United Kingdom: analysis of multilocus enzyme electrophoresis, pulsed-field gel electrophoresis, and antimicrobial resistance patterns.J. Clin. Microbiol.341996853859
    OpenUrlAbstract/FREE Full Text
  18. 18.↵
    1. Hansman D.,
    2. Bullen M. M.
    A resistant pneumococcus.Lancetii1967264265
    OpenUrl
  19. 19.
    1. Jabes D.,
    2. Nachman S.,
    3. Tomasz A.
    Penicillin-binding protein families: evidence for the clonal nature of penicillin-resistance in clinical isolates of pneumococci.J. Infect. Dis.15919891625
    OpenUrlCrossRefPubMedWeb of Science
  20. 20.↵
    1. Jacobs M. R.,
    2. Koornhof H. J.,
    3. Robins-Browne R. M.,
    4. Stevenson C. M.,
    5. Vermaak Z. A.,
    6. Freiman I.,
    7. Miller G. B.,
    8. Witcomb M. A.,
    9. Isaacson M.,
    10. Ward J. I.,
    11. Austrian R.
    Emergence of multiply resistant pneumococci.N. Engl. J. Med.2991978735740
    OpenUrlCrossRefPubMedWeb of Science
  21. 21.↵
    1. Kam K. M.,
    2. Luey K. Y.,
    3. Fung S. M.,
    4. Yiu P. P.,
    5. Harden T. J.,
    6. Cheung M. M.
    Emergence of multiple-antibiotic-resistant Streptococcus pneumoniae in Hong Kong.Antimicrob. Agents Chemother.39199526672670
    OpenUrlAbstract/FREE Full Text
  22. 22.↵
    1. Klugman K. P.
    Pneumococcal resistance to antibiotics.Clin. Microbiol. Rev.31990171196
    OpenUrlAbstract/FREE Full Text
  23. 23.↵
    1. Klugman K. P.,
    2. Coffey T. J.,
    3. Smith A.,
    4. Wasas A.,
    5. Meyers M.,
    6. Spratt B. G.
    Cluster of erythromycin-resistant variant of the Spanish multiply resistant 23F clone of Streptococcus pneumoniae in South Africa.Eur. J. Clin. Microbiol. Infect. Dis.131994171174
    OpenUrlCrossRefPubMedWeb of Science
  24. 24.↵
    1. Koeuth T.,
    2. Versalovic J.,
    3. Lupski J. R.
    Differential subsequence conservation of interspersed repetitive Streptococcus pneumoniae BOX elements in diverse bacteria.Genome Res.51995408418
    OpenUrlAbstract/FREE Full Text
  25. 25.↵
    1. Kristinsson K. G.
    Epidemiology of penicillin-resistant pneumococci in Iceland.Microb. Drug Resist.11995121125
    OpenUrlCrossRefPubMedWeb of Science
  26. 26.↵
    1. Laible G.,
    2. Spratt B. G.,
    3. Hakenbeck R.
    Interspecies recombinational events during the evolution of altered PBP2X genes in penicillin-resistant clinical isolates of Streptococcus pneumoniae.Mol. Microbiol.5199119932202
    OpenUrlCrossRefPubMedWeb of Science
  27. 27.↵
    1. Leclercq R.,
    2. Courvalin P.
    Bacterial resistance to macrolide, lincosamide, and streptogramin antibiotics by target modification.Antimicrob. Agents Chemother.35199112671272
    OpenUrlFREE Full Text
  28. 28.↵
    1. Lefèvre J. C.,
    2. Faucon G.,
    3. Sicard A. M.,
    4. Gasc A. M.
    DNA fingerprinting of Streptococcus pneumoniae strains by pulsed-field gel electrophoresis.J. Clin. Microbiol.31199327242728
    OpenUrlAbstract/FREE Full Text
  29. 29.↵
    1. Lefèvre J. C.,
    2. Bertrand M. A.,
    3. Faucon G.
    Molecular analysis by pulsed-field gel electrophoresis of penicillin-resistant Streptococcus pneumoniae from Toulouse, France.Eur. J. Clin. Microbiol. Infect. Dis.141995491497
    OpenUrlCrossRefPubMedWeb of Science
  30. 30.↵
    1. Marchese A.,
    2. Ramirez M.,
    3. Schito G. C.,
    4. Tomasz A.
    Molecular epidemiology of penicillin-resistant Streptococcus pneumoniae isolates recovered in Italy from 1993 to 1996.J. Clin. Microbiol.36199829442949
    OpenUrlAbstract/FREE Full Text
  31. 31.↵
    1. Marton A.,
    2. Gulyas M.,
    3. Munoz R.,
    4. Tomasz A.
    Extremely high incidence of antibiotic resistance in clinical isolates of Streptococcus pneumoniae in Hungary.J. Infect. Dis.1631991542548
    OpenUrlCrossRefPubMedWeb of Science
  32. 32.
    1. McDougal L. K.,
    2. Facklam R.,
    3. Reeves M.,
    4. Hunter S.,
    5. Swenson J. M.,
    6. Hill B. C.,
    7. Tenover F. C.
    Analysis of multiply antimicrobial-resistant isolates of Streptococcus pneumoniae from the United States.Antimicrob. Agents Chemother.36199221762184
    OpenUrlAbstract/FREE Full Text
  33. 33.↵
    1. McDougal L. K.,
    2. Rasheed J. K.,
    3. Biddle J. W.,
    4. Tenover F. C.
    Identification of multiple clones of extended-spectrum cephalosporin-resistant Streptococcus pneumoniae isolates in the United States.Antimicrob. Agents Chemother.39199522822288
    OpenUrlAbstract/FREE Full Text
  34. 34.↵
    1. McGee L.,
    2. Klugman K. P.,
    3. Friedland D.,
    4. Lee H. J.
    Spread of the Spanish multi-resistant serotype 23F clone of Streptococcus pneumoniae to Seoul, Korea.Microb. Drug Resist.31997253257
    OpenUrlPubMedWeb of Science
  35. 35.↵
    1. Melander E.,
    2. Ekdahl K.,
    3. Hansson H. B.,
    4. Kamme C.,
    5. Laurell M.,
    6. Nilsson P.,
    7. Persson K.,
    8. Söderström M.,
    9. Mölstad S.
    Introduction and clonal spread of penicillin- and trimethoprim-sulphamethoxazole-resistant Streptococcus pneumoniae, serotype 9V, in southern Sweden.Microb. Drug Resist.419987178
    OpenUrlPubMedWeb of Science
  36. 36.↵
    1. Moissenet D.,
    2. Valcin M.,
    3. Marchand V.,
    4. Garabédian E.-N.,
    5. Geslin P.,
    6. Garbarg-Chenon A.,
    7. Vu-Thien H.
    Molecular epidemiology of Streptococcus pneumoniae with decreased susceptibility to penicillin in a Paris children's hospital.J. Clin. Microbiol.351997298301
    OpenUrlAbstract/FREE Full Text
  37. 37.↵
    1. Munoz R.,
    2. Coffey T. J.,
    3. Daniels M.,
    4. Dowson C. G.,
    5. Laible G.,
    6. Casal J.,
    7. Hakenbeck R.,
    8. Jacobs M.,
    9. Musser J. M.,
    10. Spratt B. G.,
    11. Tomasz A.
    Intercontinental spread of a multiresistant clone of serotype 23F Streptococcus pneumoniae.J. Infect. Dis.1641991302306
    OpenUrlCrossRefPubMedWeb of Science
  38. 38.
    1. Munoz R.,
    2. Musser J. M.,
    3. Crain M.,
    4. Briles D. E.,
    5. Marton A.,
    6. Parkinson A. J.,
    7. Sorensen U.,
    8. Tomasz A.
    Geographic distribution of penicillin-resistant clones of Streptococcus pneumoniae: characterisation by penicillin-binding protein profile, surface protein A typing, and multilocus enzyme analysis.Clin. Infect. Dis.151992112118
    OpenUrlCrossRefPubMedWeb of Science
  39. 39.↵
    National Committee for Clinical Laboratory Standards Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically, 5th ed. Publication M7–A5. 2000 National Committee for Clinical Laboratory Standards Wayne, Pa
  40. 40.↵
    1. Nesin M.,
    2. Ramirez M.,
    3. Tomasz A.
    Capsular transformation of a multi-drug resistant Streptococcus pneumoniae in vivo.J. Infect. Dis.1771998707713
    OpenUrlCrossRefPubMedWeb of Science
  41. 41.↵
    1. Overweg K.,
    2. Hermans P. W. M.,
    3. Trzcinski K.,
    4. Sluijter M.,
    5. de Groot R.,
    6. Hryniewicz W.
    Multidrug-resistant Streptococcus pneumoniae in Poland: identification of emerging clones.J. Clin. Microbiol.37199917391745
    OpenUrlAbstract/FREE Full Text
  42. 42.↵
    1. Reichmann P.,
    2. Varon E.,
    3. Gunther E.,
    4. Reinert R. R.,
    5. Luttiken R.,
    6. Marton A.,
    7. Geslin P.,
    8. Wagner J.,
    9. Hakenbeck R.
    Penicillin-resistant Streptococcus pneumoniae in Germany: genetic relationship to clones from other European countries.J. Med. Microbiol.431995377385
    OpenUrlCrossRefPubMedWeb of Science
  43. 43.↵
    1. Rossi A.,
    2. Corso A.,
    3. Pace J.,
    4. Regueira M.,
    5. Tomasz A.
    Penicillin-resistant Streptococcus pneumoniae in Argentina: frequent occurrence of an internationally spread serotype 14.Microb. Drug Resist.41998225231
    OpenUrlPubMedWeb of Science
  44. 44.↵
    1. Sá-Leão R.,
    2. Tomasz A.,
    3. Santos Sanches I.,
    4. Brito-Avô A.,
    5. Vilhelmsson S. E.,
    6. Kristinsson K. G.,
    7. de Lencastre H.
    Carriage of internationally-spread epidemic clones of Streptococcus pneumoniae with unusual drug resistance patterns in children attending day care centers in Lisbon, Portugal.J. Infect. Dis.182200011531160
    OpenUrlCrossRefPubMedWeb of Science
  45. 45.↵
    1. Sá-Leão R.,
    2. Tomasz A.,
    3. Santos Sanches I.,
    4. Nunes S.,
    5. Alves C. R.,
    6. Brito-Avô A.,
    7. Saldanha J.,
    8. Kristinsson K. G.,
    9. de Lencastre H.
    Genetic diversity and clonal patterns among antibiotic-susceptible and -resistant Streptococcus pneumoniae colonizing children: day care centers as autonomous epidemiological units.J. Clin. Microbiol.38200041374144
    OpenUrlAbstract/FREE Full Text
  46. 46.↵
    1. Setchanova L.,
    2. Tomasz A.
    Molecular characterization of penicillin-resistant Streptococcus pneumoniae isolates from Bulgaria.J. Clin. Microbiol.371999638648
    OpenUrlAbstract/FREE Full Text
  47. 47.↵
    1. Shi Z.-Y.,
    2. Enright M. C.,
    3. Wilkinson P.,
    4. Griffiths D.,
    5. Spratt B. G.
    Identification of the three major clones of multiply antibiotic-resistant Streptococcus pneumoniae in Taiwanese hospitals by multilocus sequencing typing.J. Clin. Microbiol.36199835143519
    OpenUrlAbstract/FREE Full Text
  48. 48.↵
    1. Sibold C.,
    2. Wang J.,
    3. Henrichsen J.,
    4. Hakenbeck R.
    Genetic relationships of penicillin-susceptible and -resistant Streptococcus pneumoniae strains isolated on different continents.Infect. Immun.60199241194126
    OpenUrlAbstract/FREE Full Text
  49. 49.
    1. Sloas M. M.,
    2. Barrett F. F.,
    3. Chesney P. J.,
    4. English B. K.,
    5. Hill B. C.,
    6. Tenover F. C.,
    7. Leggiadro R. J.
    Cephalosporin treatment failure in penicillin- and cephalosporin-resistant Streptococcus pneumoniae meningitis.Pediatr. Infect. Dis.111992662666
    OpenUrl
  50. 50.↵
    1. Sluijter M.,
    2. Faden H.,
    3. de Groot R.,
    4. Lemmens N.,
    5. Goessens W. H. F.,
    6. van Belkum A.,
    7. Hermans P. W. M.
    Molecular characterization of pneumococcal nasopharynx isolates collected from children during their first 2 years of life.J. Clin. Microbiol.36199822482253
    OpenUrlAbstract/FREE Full Text
  51. 51.↵
    1. Smith A. M.,
    2. Klugman K. P.
    Three predominant clones identified within penicillin-resistant South African isolates of Streptococcus pneumoniae.Microb. Drug Resist.31997385389
    OpenUrlPubMedWeb of Science
  52. 52.↵
    1. Soares S.,
    2. Kristinsson K. G.,
    3. Musser J. M.,
    4. Tomasz A.
    Evidence for the introduction of a multiresistant clone of serotype 6B Streptococcus pneumoniae from Spain to Iceland in the late 1980s.J. Infect. Dis.1681993158163
    OpenUrlCrossRefPubMedWeb of Science
  53. 53.↵
    1. Song J.-H.,
    2. Lee N. Y.,
    3. Ichiyama S.,
    4. Yoshida R.,
    5. Hirakata Y.,
    6. Fu W.,
    7. Chongthaleong A.,
    8. Aswapokee N.,
    9. Chiu C.-H.,
    10. Lalitha M. K.,
    11. Thomas K.,
    12. Perera J.,
    13. Yee T. T.,
    14. Jamal F.,
    15. Warsa U. C.,
    16. Vinh B. X.,
    17. Jacobs M. R.,
    18. Appelbaum P. C.,
    19. Pai C. H.,
    20. the ANSORP Study Group
    Spread of drug-resistant Streptococcus pneumoniae in Asian countries: Asian Network for Surveillance of Resistant Pathogens (ANSORP) study.Clin. Infect. Dis.28199912061211
    OpenUrlCrossRefPubMedWeb of Science
  54. 54.↵
    1. Song J.-H.,
    2. Yang J.-W.,
    3. Jin J. H.,
    4. Kim S. W.,
    5. Kim C. K.,
    6. Lee H.,
    7. Peck K. R.,
    8. Kim S.,
    9. Lee N. Y.,
    10. Jacobs M. R.,
    11. Appelbaum P. C.,
    12. the Asian Network for Surveillance of Resistant Pathogens (ANSORP) Study Group
    Molecular characterization of multidrug-resistant Streptococcus pneumoniae isolates in Korea.J. Clin. Microbiol.38200016411644
    OpenUrlAbstract/FREE Full Text
  55. 55.↵
    1. Sutcliffe J.,
    2. Tait-Kamradt A.,
    3. Wondrack L.
    Streptococcus pneumoniae and Streptococcus pyogenes resistant to macrolides but sensitive to clindamycin: a common resistance pattern mediated by an efflux system.Antimicrob. Agents Chemother.40199618171824
    OpenUrlAbstract/FREE Full Text
  56. 56.↵
    1. Tait-Kamradt A.,
    2. Clancy J.,
    3. Cronan M.,
    4. Dib-Hajj F.,
    5. Wondrack L.,
    6. Yuan W.,
    7. Sutcliffe J.
    mefE is necessary for the erythromycin-resistant M phenotype in Streptococcus pneumoniae.Antimicrob. Agents Chemother.41199722512255
    OpenUrlAbstract/FREE Full Text
  57. 57.↵
    1. Takala A. K.,
    2. Vuopio-Varkila J.,
    3. Tarkka E.,
    4. Leinonen M.,
    5. Musser J. M.
    Subtyping of common pediatric pneumococcal serotypes from invasive disease and pharyngeal carriage in Finland.J. Infect. Dis.1731996128135
    OpenUrlCrossRefPubMedWeb of Science
  58. 58.↵
    1. Tarasi A.,
    2. Sterk-Kuzmanovic N.,
    3. Sieradzki K.,
    4. Schoenwald S.,
    5. Austrian R.,
    6. Tomasz A.
    Penicillin-resistant and multidrug-resistant Streptococcus pneumoniae in a paediatric hospital in Zagreb, Croatia.Microb. Drug Resist.11995169176
    OpenUrlPubMedWeb of Science
  59. 59.↵
    1. Tarasi A.,
    2. Chong Y.,
    3. Lee K.,
    4. Tomasz A.
    Spread of the serotype 23F multidrug-resistant Streptococcus pneumoniae clone to South Korea.Microb. Drug Resist.31997105109
    OpenUrlPubMedWeb of Science
  60. 60.↵
    1. Van Belkum A.,
    2. Sluijter M.,
    3. de Groot R.,
    4. Verbrugh H.,
    5. Hermans P. W. M.
    Novel BOX repeat PCR assay for high-resolution typing of Streptococcus pneumoniae strains.J. Clin. Microbiol.34199611761179
    OpenUrlAbstract/FREE Full Text
  61. 61.↵
    1. Vaz Pato M. V.,
    2. de Carvalho C. B.,
    3. Tomasz A.,
    4. the Multicenter Study Group
    Antibiotic susceptibility of Streptococcus pneumoniae isolates in Portugal. A multicenter study between 1989 and 1993.Microb. Drug Resist.119955969
    OpenUrlPubMedWeb of Science
  62. 62.↵
    1. Versalovic J.,
    2. Kapur V.,
    3. Mason E. O.,
    4. Shah U.,
    5. Koeuth T.,
    6. Lupski J. R.,
    7. Musser J. M.
    Penicillin-resistant Streptococcus pneumoniae strains recovered in Houston: identification and molecular characterization of multiple clones.J. Infect. Dis.1671993850856
    OpenUrlCrossRefPubMedWeb of Science
  63. 63.↵
    1. Vilhelmsson S. E.,
    2. Tomasz A.,
    3. Kristinsson K. G.
    Molecular evolution in a multidrug-resistant lineage of Streptococcus pneumoniae: emergence of strains belonging to the serotype 6B Icelandic clone that lost antibiotic resistance traits.J. Clin. Microbiol.38200013751381
    OpenUrlAbstract/FREE Full Text
  64. 64.↵
    1. Zhou J.,
    2. Enright M. C.,
    3. Spratt B. G.
    Identification of the major Spanish clones of penicillin-resistant pneumococci via the Internet using multilocus sequence typing.J. Clin. Microbiol.382000977986
    OpenUrlAbstract/FREE Full Text
PreviousNext
Back to top
Download PDF
Citation Tools
Nomenclature of Major Antimicrobial-Resistant Clones of Streptococcus pneumoniae Defined by the Pneumococcal Molecular Epidemiology Network
L. McGee, L. McDougal, J. Zhou, B. G. Spratt, F. C. Tenover, R. George, R. Hakenbeck, W. Hryniewicz, J. C. Lefévre, A. Tomasz, K. P. Klugman
Journal of Clinical Microbiology Jul 2001, 39 (7) 2565-2571; DOI: 10.1128/JCM.39.7.2565-2571.2001

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Print

Alerts
Sign In to Email Alerts with your Email Address
Email

Thank you for sharing this Journal of Clinical Microbiology article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Nomenclature of Major Antimicrobial-Resistant Clones of Streptococcus pneumoniae Defined by the Pneumococcal Molecular Epidemiology Network
(Your Name) has forwarded a page to you from Journal of Clinical Microbiology
(Your Name) thought you would be interested in this article in Journal of Clinical Microbiology.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
Nomenclature of Major Antimicrobial-Resistant Clones of Streptococcus pneumoniae Defined by the Pneumococcal Molecular Epidemiology Network
L. McGee, L. McDougal, J. Zhou, B. G. Spratt, F. C. Tenover, R. George, R. Hakenbeck, W. Hryniewicz, J. C. Lefévre, A. Tomasz, K. P. Klugman
Journal of Clinical Microbiology Jul 2001, 39 (7) 2565-2571; DOI: 10.1128/JCM.39.7.2565-2571.2001
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Top
  • Article
    • ABSTRACT
    • MATERIALS AND METHODS
    • RESULTS
    • DISCUSSION
    • ACKNOWLEDGMENT
    • FOOTNOTES
    • REFERENCES
  • Figures & Data
  • Info & Metrics
  • PDF

KEYWORDS

Anti-Bacterial Agents
Bacterial Proteins
Erythromycin
Hexosyltransferases
Peptidyl Transferases
Pneumococcal Infections
Streptococcus pneumoniae
Terminology as Topic

Related Articles

Cited By...

About

  • About JCM
  • Editor in Chief
  • Board of Editors
  • Editor Conflicts of Interest
  • For Reviewers
  • For the Media
  • For Librarians
  • For Advertisers
  • Alerts
  • RSS
  • FAQ
  • Permissions
  • Journal Announcements

Authors

  • ASM Author Center
  • Submit a Manuscript
  • Article Types
  • Resources for Clinical Microbiologists
  • Ethics
  • Contact Us

Follow #JClinMicro

@ASMicrobiology

       

ASM Journals

ASM journals are the most prominent publications in the field, delivering up-to-date and authoritative coverage of both basic and clinical microbiology.

About ASM | Contact Us | Press Room

 

ASM is a member of

Scientific Society Publisher Alliance

 

American Society for Microbiology
1752 N St. NW
Washington, DC 20036
Phone: (202) 737-3600

 

Copyright © 2021 American Society for Microbiology | Privacy Policy | Website feedback

Print ISSN: 0095-1137; Online ISSN: 1098-660X