Article Figures & Data
Figures
- Fig. 1.
Specificity of multiplex PCR. Template DNA was isolated from TSB cultures of the indicated bacteria and subjected to PCR as described in the text. The approximate number of bacteria in the starting sample was 5 × 108 CFU. MT refers to cases in which template DNA was derived from mixed cultures of bacteria containing all of the nonstaphylococcal species with or without the ORSA strain UAMS-601. MS refers to those cases in which template DNA was derived from pure cultures of each nonstaphylococcal species and then mixed prior to analysis with or without template DNA from UAMS-601. (Top) Multiplex PCR utilizing primers for staphylococcal rRNA, clfA, and mecA; (bottom) PCR using primers for conserved regions of eubacterial rRNA genes. Lane M, molecular size markers. Molecular sizes (in kilobases) are on the right.
- Fig. 2.
Specificity of blood culture PCR. Blood culture bottles were inoculated with approximately 10 OSSA, ORSA, OSCNS, or ORCNS isolates. Aliquots were processed for template DNA after the culture was identified as positive as described in the text. Lane M, molecular size markers. Approximate sizes (in kilobases) of the amplification products are on the left.
- Fig. 3.
Sensitivity of blood culture PCR. A blood culture bottle containing 10 ml of venous blood was inoculated with the ORSA strain UAMS-601 and incubated for 15 h at 37°C. Serial dilutions were prepared using medium from a sterile blood culture as a diluent. DNA isolated from a 1-ml aliquot of cultures containing the indicated number of viable bacteria was subjected to PCR. Lane C, positive control with template DNA derived from a TSB culture of UAMS-601; lane M, molecular size markers. Molecular sizes (in kilobases) are on the left.
- Fig. 4.
Analysis of blood cultures by PCR. Template DNA was isolated from positive blood cultures obtained from the clinical laboratory prior to phenotypic characterization of the bacteria present in the sample. The results shown were chosen because they include all four classes of staphylococci (ORSA, OSSA, ORCNS, and OSCNS) and representative nonstaphylococcal species (SV, viridans group streptococci; PA, P. aeruginosa). (Top) Results obtained with the multiplex protocol; (bottom) results obtained with the eubacterial primers. Lane M, molecular size markers. Molecular sizes (in kilobases) are on the left.
Tables
- Table 1.
Nucleotide sequences of PCR primers
Target gene Primera Length (bp) 5′ 3′ Staphylococcal 16S rRNA CCTATAAGACTGGGATAACTTCGGG CTTTGAGTTTCAACCTTGCGGTCG 791 clfA GCAAAATCCAGCACAACAGGAAACGA CTTGATCTCCAGCCATAATTGGTGG 638 mecA TCCAGGAATGCAGAAAGACCAAAGC GACACGATAGCCATCTTCATGTTGG 499 Eubacterial 16S rRNAb AACTGGAGGAAGGTGGGGAT AGGAGGTGATCCAACCGCA 371 ↵a All primers are written 5′ to 3′ as synthesized. Design parameters for the clfA, mecA, and staphylococcal rRNA gene primers are discussed in the text.
↵b Primers for the eubacterial rRNA genes are from Schmitz et al. (25). The eubacterial rRNA primers were used to confirm the presence of genomic DNA and were not designed for use in our multiplex protocol.
