Article Figures & Data
Figures
- FIG. 1.
Phylogenetic tree of intimin variant genes constructed by the UPGMA method of Mega 2.1. Numbers on the branches represent the branch length and denote the genetic distance (e.g., number of substitutions per unit time) between the two taxa they connect. Bold numbers in italics represent bootstrap values.
- FIG. 2.
Split decomposition analysis of intimin variant genes with Splitstree. By this method, evolutionary data are canonically decomposed into a sum of weakly compatible splits and represented by a splits graph. For ideal data, this is a tree; less ideal data will give rise to a tree-like network, which can be interpreted as evidence for different and conflicting phylogenies, such as recombination in the evolutional history. Splitstree demonstrates network-like structures in the 5′ region (positions 1 to 2112) (A), the entire gene (B), and the 3′ region (positions 2112 to end) (C) of intimin alleles.
- FIG. 3.
Illustration of polymorphic sites in the 5′ regions of intimin alleles by Happlot. Vertical lines indicate polymorphic sites.
Tables
- TABLE 1.
Designations, sequence characteristics, and origin of the intimin alleles used in this study
Designation of intimin allele ORF length (bp) G+C content (%) Reference strain (serotype) Accession no. α (alpha) 2,820 42.09 E2348/69 (O127:H6) M58154 β (beta) 2,820 42.98 RDEC-1 (O15:H−) AF200363 γ 1 (gamma 1) 2,805 42.67 EDL933 (O157:H7) Z11541.1 γ 2 (gamma 2) 2,808 42.95 95NR1 (O111:H−) AF025311 ε (epsilon) 2,847 42.78 PMK5 (O103:H2) AF116899 ζ (zeta) 2,817 42.60 537/89 (O84:NM) AJ298279 4795/95 (O84:H4) AJ271407 η (eta) 2,847 42.50 CF11201 (O125:H−) AJ308550 θ (theta) 2,808 43.07 CL37 (O111:H8) AF449418 ι (iota) 2,814 41.70 7476/96 (O145:H4) AJ308551 κ (kappa) 2,820 42.06 6044/95 (O118:H5) AJ308552 - TABLE 2.
PCR primers and conditions for amplification of intimin alleles
Primerc Sequence of primer (5′ → 3′) Target sequence Reference strain(s) PCR program Size of product (bp) Reference SK1 CCCGAATTCGGCACAAGCATAAGC Conserved re- gion of eae 94°C, 30 s; 52°C, 60 s; 72°C, 60 sa,b 863 32 SK2 CCCGGATCCGTCTCGCCAGTATTCG EDL933, E2348/69 LP2 CCCGAATTCTTATTTTACACAAGTGGC eae-α E2348/69 94°C, 30 s; 55°C, 60 s; 72°C, 120 sa,b 2,807 33 LP3 CCCGAATTCTTATTCTACACAAACCGC eae-γ EDL933 94°C, 30 s; 48°C, 60 s; 72°C, 90 sa, b 2,792 33 94°C, 30 s; 55°C, 60 s; 72°C, 90 sb, e LP4 CCCGTGATACCAGTACCAATTACGGTC eae-β RDEC-1 94°C, 30 s; 55°C, 60 s; 72°C, 120 sa,b 2,287 28 LP5 AGCTCACTCGTAGATGACGGCAAGCG eae-ε PMK5 94°C, 30 s; 55°C, 60 s; 72°C, 120 sa,b 2,608 28 LP6B TAGTTGTACTCCCCTTATCC eae-ζ 4795/95 94°C, 30 s; 53°C, 60 s; 72°C, 150 sa,b 2,430 This study LP7 TTTATCCTGCTCCGTTTGCT eae-ι 7476/97 94°C, 30 s; 52°C, 60 s; 72°C, 150 sa,b 2,685 This study LP8 TAGATGACGGTAAGCGAC eae-η CF11201 94°C, 30 s; 52°C, 60 s; 72°C, 150 sa,b 2,590 This study LP10 GGCATTGTTATCTGTTGTCT eae-κ 6044/95 94°C, 30 s; 52°C, 60 s; 72°C, 150 sa,b 2,769 This study LP11B GTTGATAACTCCTGATATTTTA eae-θ CL-37 94°C, 30 s; 50°C, 60 s; 72°C, 150 sa 2,686 This study 94°C, 30 s; 50°C, 60 s; 72°C, 150 sb ↵ a Before the first cycle the sample was denatured for 2 min at 94°C.
↵ b After the last cycle, the sample was extended for 5 min at 72°C.
↵ c Primer SK1 was used as forward primer in all PCR approaches in combination with SK2, LP2, LP3, LP4, LP5, LP6B, LP7, LP8, LP10, and LP11B.
d Three cycles
↵ e Twenty-eight cycles.
- TABLE 3.
Sequence pair distances of intimin genes on the basis of a ClustalW alignment using sequence distance matrix from Bioedit
Gene Distance with respect toa: α β γ1 γ2 ε ζ η θ ι κ α 1.000 0.833 0.857 0.845 0.824 0.916 0.847 0.845 0.870 0.879 β 1.000 0.830 0.840 0.863 0.827 0.818 0.838 0.828 0.886 γ1 1.000 0.913 0.832 0.846 0.841 0.909 0.870 0.856 γ2 1.000 0.840 0.829 0.828 0.992 0.859 0.843 ε 1.000 0.816 0.921 0.839 0.830 0.819 ζ 1.000 0.835 0.828 0.850 0.858 η 1.000 0.828 0.846 0.853 θ 1.000 0.858 0.841 ι 1.000 0.868 κ 1.000 ↵ a Values represent ratios of identities to the length of the longer sequence of a given pair. Values in bold type are mentioned in the text.
- TABLE 4.
Number and distribution of singleton polymorphic sites and parsimony-informative polymorphic sites with two, three, and four different nucleotides in the 5′ and 3′ regions of 10 aligned intimin genes
Sitea (no. of nucleotides) No. of sites in region: 5′ 3′ SPM (2) 108 45 PIPM (2) 200 185 SPM (3) 6 9 PIPM (3) 27 157 SPM (4) 0 0 PIPM (4) 7 57 ↵ a SPM, singleton polymorphic sites; PIPM, parsimony-informative polymorphic sites.
- TABLE 5.
Frequency of eae types in 111 stx-negative E. coli isolates from patients and carriers
eae type No. of strains Serotype (no. of strains) α 3 ONT:HNT, O63:H29; O132:H4 β 38 O26:H− (12), O26:H11 (9), O14:H−, O81:H−, O90:H−, O108:H−, O103:H2, O5:H4, O121:H−, O20:H−, O33:H6, O33:H2, ONT:H6, Orough:H26, ONT:H32, Orough:HNT, Orough:H11, O145:HNT (2) γ 35 O157:H− (11), O145:H− (7), O145:HNT, O145:H19, O25:H28, O70:H11, O76:H8 (2); O76:H−, O2:H37, O8:H− (2), Orough:H19, ONT:H33, O111:H2, O118:HNT, O125:HNT, O156:H25, O156:H35 ε 14 O103:H3, O103:H2 (3), O103:H− (3), O96:H19, ONT:HNT, O121:H−, O157:H−, O8:H−, Orough:H− (2) ζ 5 O156:H25, O104:H−, O85:H− (2), O105:H31 η 3 O125:H−; O2:H49,a O12:H19a θ 0 ι 6 O145:H4 (3), ONT:H8, Orough:HNT, O98:H2 κ 2 O118:H5; O157:H42a NDb 5 ONT:H−/HNT (2), O5:H−, O132:H4, O54:H−
