Evaluation of Reverse Transcription-PCR Assays for Rapid Diagnosis of Severe Acute Respiratory Syndrome Associated with a Novel Coronavirus

W. C. Yam; K. H. Chan; L. L. M. Poon; Y. Guan; K. Y. Yuen; W. H. Seto; J. S. M. Peiris

doi:10.1128/JCM.41.10.4521-4524.2003

DOI: 10.1128/JCM.41.10.4521-4524.2003

Article Figures & Data

Tables

TABLE 1.

RT-PCR protocols for rapid diagnosis of CoV associated with SARS^a

Characteristic or component of protocol	WHO-HKU		WHO-Hamburg
Characteristic or component of protocol	RT	PCR	RT-PCR	Second PCR
Primer sequences
Sense		TACACACCTCAGCGTTG	ATGAATTACCAAGTCAATGGTTAC	GAAGCTATTCGTCACGTTCG
Antisense		CACGAACGTGACGAAT	CATAACCAGTCGGTACAGCTAC	CTGTAGAAAATCCTAGCTGGAG
Reagent formulation	Superscript II RTA (Invitrogen)	AmpliTaq Gold (Roche)	Superscript II RT-PCR (Invitrogen)	AmpliTaq Gold (Roche)
	(i) 4 μl of 5× first-strand buffer	(i) 5 μl of 10× reaction buffer	(i) 10 μl of 2× reaction buffer	(i) 5 μl of 10× reaction buffer
	(ii) 10 mM DTT	(ii) 200 μM dNTP	(ii) 2.45 mM MgSO₄	(ii) 200 μM dNTP
	(iii) 500 μM dNTP	(iii) 2.5 mM MgSO₄	(iii) 500 nM (each) primer	(iii) 2.5 mM MgSO₄
	(iv) 0.15 μg of random primer	(iv) 250 nM (each) primer	(iv) 0.4 μl of RTA-Taq mixture	(iv) 200 nM (each) primer
	(v) 200 U of Superscript II	(v) 2 U of AmpliTaq Gold	(v) 2 μl of RNA extract	(v) 2 U of AmpliTaq Gold
	(vi) 12 μl of RNA extract	(vi) 2 μl of RT product	(vi) Make up to total volume of 20 μl	(vi) 1 μl of RT-PCR product
	(vii) Make up to total volume of 20 μl	(vii) Make up to total volume of 50 μl		(vii) Make up to total volume of 50 μl
Thermal cycling profile	(i) 25°C, 10 min	(i) 94°C, 10 min	(i) 45°C, 30 min	(i) 95°C, 5 min
	(ii) 42°C, 50 min	(ii) 40 cycles	(ii) 95°C, 3 min	(ii) 10 cycles
	(iii) 94°C, 3 min	(a) 94°C, 30 s	(iii) 10 cycles	(a) 95°C, 10 s
		(b) 50°C, 40 s	(a) 95°C, 10 s	(b) 60°C, 10 s (decrease by 1°C/cycle)
		(c) 72°C, 15 s	(b) 60°C, 10 s (decrease by 1°C/cycle)	(c) 72°C, 20 s
		(iii) 72°C, 10 min	(c) 72°C, 30 s	(iii) 20 cycles
			(iv) 40 cycles	(a) 95°C, 10 s
			(a) 95°C, 10 s	(b) 56°C, 10 s
			(b) 56°C, 10 s	(c) 72°C, 20 s
			(c) 72°C, 30 s
Expected PCR product size (bp)		182	189	108

↵ a The RT-PCR protocols of two WHO SARS network laboratories, WHO-HKU (8) and WHO-Hamburg (4), are also available online (http://www.who.int/esr/sars/primers/en . Abbreviations: RTA, reverse transcriptase; DTT, dithiothreitol; dNTP, deoxynucleoside triphasphate.

TABLE 2.

Performance of RT-PCR assays for rapid detection of CoV associated with SARS

Specimens (no.)	No. of specimens tested	Seroconversion^a	No. of specimens positive by RT-PCR assay
Specimens (no.)	No. of specimens tested	Seroconversion^a	WHO-HKU	WHO-Hamburg	Both WHO-HKU and WHO-Hamburg
Clinically suspected SARS
Nasopharygneal aspirate specimens (124)	72	+	44	49	43
	52	−	0	0	0
Throat swab specimens (65)	54	+	35	39	33
	11	−	0	0	0
Urine specimens (95)	78	+	39	42	39
	17	−	0	0	0
Stool specimens (19)	19	+	11	12	11
Controls
Nasopharygneal aspirate specimens	22^b	ND	0	0	0
Stool specimens	21^c	ND	0	0	0

↵ a A fourfold rise or more in antibody titer against CoV was considered seroconversion (+). ND, not done.
↵ b Samples positive for other viral pathogens included nine samples positive for influenza virus A, one sample positive for influenza virus B, six samples positive for adenovirus, and six samples positive for RSV by immunofluorescence (2).
↵ c No intestinal pathogens detected.