Article Figures & Data
Tables
- TABLE 1.
RT-PCR protocols for rapid diagnosis of CoV associated with SARSa
Characteristic or component of protocol WHO-HKU WHO-Hamburg RT PCR RT-PCR Second PCR Primer sequences Sense TACACACCTCAGCGTTG ATGAATTACCAAGTCAATGGTTAC GAAGCTATTCGTCACGTTCG Antisense CACGAACGTGACGAAT CATAACCAGTCGGTACAGCTAC CTGTAGAAAATCCTAGCTGGAG Reagent formulation Superscript II RTA (Invitrogen) AmpliTaq Gold (Roche) Superscript II RT-PCR (Invitrogen) AmpliTaq Gold (Roche) (i) 4 μl of 5× first-strand buffer (i) 5 μl of 10× reaction buffer (i) 10 μl of 2× reaction buffer (i) 5 μl of 10× reaction buffer (ii) 10 mM DTT (ii) 200 μM dNTP (ii) 2.45 mM MgSO4 (ii) 200 μM dNTP (iii) 500 μM dNTP (iii) 2.5 mM MgSO4 (iii) 500 nM (each) primer (iii) 2.5 mM MgSO4 (iv) 0.15 μg of random primer (iv) 250 nM (each) primer (iv) 0.4 μl of RTA-Taq mixture (iv) 200 nM (each) primer (v) 200 U of Superscript II (v) 2 U of AmpliTaq Gold (v) 2 μl of RNA extract (v) 2 U of AmpliTaq Gold (vi) 12 μl of RNA extract (vi) 2 μl of RT product (vi) Make up to total volume of 20 μl (vi) 1 μl of RT-PCR product (vii) Make up to total volume of 20 μl (vii) Make up to total volume of 50 μl (vii) Make up to total volume of 50 μl Thermal cycling profile (i) 25°C, 10 min (i) 94°C, 10 min (i) 45°C, 30 min (i) 95°C, 5 min (ii) 42°C, 50 min (ii) 40 cycles (ii) 95°C, 3 min (ii) 10 cycles (iii) 94°C, 3 min (a) 94°C, 30 s (iii) 10 cycles (a) 95°C, 10 s (b) 50°C, 40 s (a) 95°C, 10 s (b) 60°C, 10 s (decrease by 1°C/cycle) (c) 72°C, 15 s (b) 60°C, 10 s (decrease by 1°C/cycle) (c) 72°C, 20 s (iii) 72°C, 10 min (c) 72°C, 30 s (iii) 20 cycles (iv) 40 cycles (a) 95°C, 10 s (a) 95°C, 10 s (b) 56°C, 10 s (b) 56°C, 10 s (c) 72°C, 20 s (c) 72°C, 30 s Expected PCR product size (bp) 182 189 108 ↵a The RT-PCR protocols of two WHO SARS network laboratories, WHO-HKU (8) and WHO-Hamburg (4), are also available online (http://www.who.int/esr/sars/primers/en. Abbreviations: RTA, reverse transcriptase; DTT, dithiothreitol; dNTP, deoxynucleoside triphasphate.
- TABLE 2.
Performance of RT-PCR assays for rapid detection of CoV associated with SARS
Specimens (no.) No. of specimens tested Seroconversiona No. of specimens positive by RT-PCR assay WHO-HKU WHO-Hamburg Both WHO-HKU and WHO-Hamburg Clinically suspected SARS Nasopharygneal aspirate specimens (124) 72 + 44 49 43 52 − 0 0 0 Throat swab specimens (65) 54 + 35 39 33 11 − 0 0 0 Urine specimens (95) 78 + 39 42 39 17 − 0 0 0 Stool specimens (19) 19 + 11 12 11 Controls Nasopharygneal aspirate specimens 22b ND 0 0 0 Stool specimens 21c ND 0 0 0 ↵a A fourfold rise or more in antibody titer against CoV was considered seroconversion (+). ND, not done.
↵b Samples positive for other viral pathogens included nine samples positive for influenza virus A, one sample positive for influenza virus B, six samples positive for adenovirus, and six samples positive for RSV by immunofluorescence (2).
↵c No intestinal pathogens detected.
