Persistence of Two Genotypes of Neisseria gonorrhoeae during Transmission

Collection and characterization of isolates.Isolates of N. gonorrhoeae were obtained from all infected patients attending the GUM clinic at the Royal Hallamshire Hospital, Sheffield, United Kingdom, from April 1995 to March 1997. Isolates from the same individual were included only when more than 28 days had elapsed between the positive cultures for their first and repeat infections, to exclude isolates that were potential treatment failures. Test of cure in the United Kingdom is recommended within 1 month of treatment for gonorrhea (http://www.agum.org.uk/guidelines.htm ). N. gonorrhoeae was isolated on Columbia agar base medium (Unipath, Basingstoke, Hampshire, United Kingdom), supplemented with 5% lysed horse blood, vancomycin (3 mg/liter), trimethoprim (5 mg/liter), and colistin (8 mg/liter). Isolates were saved in 15% glycerol broth and stored at −80°C. Isolates were retrieved as previously described (25). All strains were typed on the basis of their nutritional requirement, by testing for the ability to utilize proline, ornithine, hypoxanthine, methionine, uracil, and histidine (4). Serotyping was performed using the method and nomenclature of Knapp et al. (12). opa typing of all isolates was performed using the method of O'Rourke et al. (20) as previously described (25). Briefly, opa genes were amplified by PCR from a bacterial lysate, which was then purified by gel excision using a Nucleiclean kit (Sigma, Poole, Dorset, United Kingdom). The product was then digested with the restriction enzyme TaqI using the recommended method of the manufacturer (New England Biolabs, Hitchin, Hertfordshire, United Kingdom). The resulting fragments were end labeled with [³²P]dCTP (ICN, Basingstoke, Hampshire, United Kingdom) and separated by electrophoresis on a 6% nondenaturing polyacrylamide gel. Profiles were analyzed using Gelcompar (Applied Maths, Kortrijk, Belgium) and were considered indistinguishable only if all bands were identical.

Patient data.Contact tracing data from patients with gonorrhea were obtained by interviews with health advisers at the GUM clinic as previously described (25). Data including age, ethnicity, partial postal code, and information on sexual partnerships in the previous 3 months were sought. Ethics approval was obtained. Patients were offered the choice of notifying their own sexual partners of their infection or providing contact information in order for the health adviser to inform the sexual partners confidentially.

Intragenic recombination.Four isolates from each of the two opa type clusters (opa-1 and opa-4), two from women and two from men, one from each year, were subcultured daily using a sweep from multiple colonies on GC agar (Difco, Becton Dickinson, Oxford, United Kingdom) supplemented with 1% IsoVitaleX (BBL, Becton Dickinson, Oxford, United Kingdom). DNA lysates were prepared on days 1, 7, 14, 21, and 28 and used as the DNA source for opa typing (25).

Intergenic recombination.Transformation experiments were performed using chromosomal DNA from donor strains FA19 Rif^r (rifampin-resistant gonococcal strain FA19) (13) or ciprofloxacin-resistant strains that had a single gyrA mutation (gyrA AA91 = Phe), or double gyrA mutation (gyrA AA91 = Phe, AA95 = Gly). DNA was extracted according to the manufacturer's recommended method using a Qiamp kit (QIAGEN, Crawley, West Sussex, United Kingdom), and the concentration of the chromosomal DNA was determined using a spectrophotometer (Shimadzu, Milton Keynes, Buckinghamshire, United Kingdom) with its DNA concentration program. The absorbance of the sample was measured at 260 and 280 nm; a 50-μg/ml concentration of double-stranded DNA gives an optical density (OD) of 1.0 at 260 nm, and the ratio of the OD readings provides an estimate of the purity of the DNA.

Transformation experiments were performed using a suspension of a pilated culture of the recipient isolate prepared in Proteose Peptone with an OD at 540 nm of 1.0 (11). Recipient isolates for the transformation were two isolates from each of the two opa type clusters, the opa-1 and opa-4 clusters, and a clinical isolate that had not been stored at −80°C; all of the isolates were sensitive to rifampin and ciprofloxacin. One hundred microliters of the recipient suspension was placed onto a GC agar plate to which 100 μl of 0.5-μg/ml chromosomal DNA from FA19 Rif^r was added, and the plate was incubated at 36°C with 5% CO₂ for 6 h. The growth was suspended in 1 ml of Proteose Peptone (Difco, Becton Dickinson), 100 μl was placed onto a GC agar plate containing rifampin (50 μg/ml) in duplicate, the plate was incubated for up to 5 days at 36°C with 5% CO₂, and the number of transformants was determined. The total viable count was determined on GC agar. The experiments were repeated using the same recipients with donor DNA from the ciprofloxacin-resistant isolates. Selection of transformants was performed on GC agar plates containing ciprofloxacin at a concentration of 1.0 μg/ml for the DNA from the donor isolate with the double gyrA mutation (MIC of ciprofloxacin, 16.0 μg/ml) or 0.12 μg/ml for the DNA from the donor isolate with a single gyrA mutation (MIC of ciprofloxacin, 1.0 μg/ml). Negative controls to which no donor DNA was added were included in each experiment. Transformation experiments were repeated three times. A selection of transformants from each experiment were auxotyped, serotyped, and opa typed.

por gene sequencing.Eight isolates from each of the two opa type clusters that were isolated throughout the 2-year period were selected. Four control isolates with the same auxotype and serovar as the two clusters, isolated from patients attending the GUM clinic at St. Mary's Hospital, London, United Kingdom, were also sequenced with respect to the por gene. The por gene was amplified from DNA lysates, using primers spanning from the nonencoding region, based on the numbering of FA19 (14) (por1, 5′-⁷²GAATTCAAGCTTATGAAAAAATCCCTGATTGCCC¹⁰⁵-3′) to the postencoding region (por2, 5′-¹⁰⁵²GTCGACCTGCAGTTAGAATTTGTGGCGCAGA¹⁰⁶⁴-3′). Each PCR contained a 200 μM concentration of each deoxynucleoside triphosphate (dATP, dCTP, dGTP, and dTTP) (Roche, Lewes, East Sussex, United Kingdom), 10 μl of PCR buffer (20 mM Tris-HCl [pH 8.4], 50 mM KCl) (Gibco BRL, Paisley, United Kingdom), 1.5 mM MgCl_2, 50 pmol of each primer, and 5 μl of DNA lysate. The reaction mix was overlaid with a drop of mineral oil, the samples were heated to 95°C using a Hybaid Ominigene PCR machine for 5 min, and then 2.5 U of Taq DNA polymerase (Gibco BRL) was added. Amplification was performed using 30 cycles of 94°C for 1 min, 60°C for 1 min, and 72°C for 1 min, with a final extension of 72°C for 5 min, and then the mixture was held at 4°C.

The PCR product was purified by gel excision using a Geneclean kit (Bio 101, Stratagene, Amsterdam, The Netherlands). The sequencing reaction was performed using six internal primers (por3, 5′-⁴⁹⁵TTCAGGCTACCGGCGGATG⁴⁷⁵-3′; por4, 5′-⁶³⁸TTCAGCGGCAGCGTACAATAC⁶⁵⁸-3′; por5, 5′-⁸⁸³GACGTACAGGGCATTATTGTC⁸⁶³-3′; BDR 81, 5′-⁴⁷⁶ATCCGCGCCGGTAGCCTGAAC⁴⁹⁶-3′; BDR 82, 5′-⁶⁵⁸GTATTGTACGCTGCCGCTGAA⁶³⁷-3′; and BDR 83, 5′-⁸⁶⁰TACGACAATAATGCCCTGTAC⁸⁸⁰-3′). Each reaction mix contained 8 μl of terminator ready reaction mix (Perkin-Elmer, Cambridge, United Kingdom), 6 μl of purified PCR product, 3 pmol of primer, and water to a final volume of 20 μl. Amplification was performed on a Robocycler (Perkin-Elmer) at 96°C for 30 s, 50°C for 15 s, and 60°C for 4 min for 25 cycles, and then the mixture was cooled to 4°C. The sequencing reaction product was purified by ethanol precipitation. To each 20-μl volume, 2 μl of 3 M sodium acetate, pH 4.6, and 50 μl of 95% ethanol was added; the solution was then vortexed and placed on ice for 10 min. The solution was then centrifuged at 5,000 × g for 20 min before the supernatant was removed. The pellet was washed in 250 μl of 70% ethanol and centrifuged for 10 min at 5,000 × g, and the supernatant was removed. The pellet was dried on a hot block, prior to the addition of 25 μl of template suppression reagent (Perkin-Elmer). The sample was vortexed and centrifuged to form a pellet and was heated to 95°C for 2 min to denature. The sample was vortexed and centrifuged to form a pellet again and was loaded onto an ABI Prism 310 sequencer (Perkin-Elmer). Sequences were analyzed and aligned using Sequencher (Gene Codes Corporation, Ann Arbor, Mich.).

Statistical analysis.Chi-square tests, where appropriate, were performed in Microsoft Excel.

Nucleotide sequence accession numbers.All sequences have been submitted to GenBank and have the following accession numbers: AY297696 to AY297711 .

opa typing. opa typing revealed 115 different opa profiles (Table 1) within the 314 isolates, of which 75 (23.9%) were unique, and two different types, previously designated the opa-1 and opa-4 clusters (25), accounted for 41.7% of the strains. The two large clusters of 62 (opa-1) and 69 (opa-4) isolates with indistinguishable opa profiles persisted throughout the 2-year study period (Fig. 1).

• Open in new tab
• Download powerpoint

FIG. 1.

(A) Total number of isolates of N. gonorrhoeae collected by month and the incidence of opa-1 and opa-4 isolates; (B) distribution of opa-1 and opa-4 clusters in relation to the proportion of isolates collected by month.

The opa-1 cluster was composed of 62 isolates, 57 of which were of a PA(O)U IB-2 phenotype and 5 of which had a different serovar (IB-1, IB-16, and IB-26) that occurred sporadically throughout the time span. Information about sexual partners was available for 49 of the 62 patient episodes. There were some known transmission links within the cluster: three pairs, three triplets, one group of five, and 10 links to individuals who did not have an opa-1 profile, with the remaining individuals for whom isolates were available not reporting any direct sexual contacts. The median number of contacts, traced and untraced, for women was 1.0 (range, 0 to 3; mean, 1.25), and that for men was 2.0 (range, 0 to 8; mean, 2.7). (Table 2). All of the individuals were heterosexual, and there were significantly more women within the opa-1 cluster than in other clusters (P = 0.003 [χ² test]).

The opa-4 cluster was composed of 69 isolates, of which 66 isolates had an A IB-3 phenotype and 3 had a different phenotype (A IA-2 and NR IB-3) that occurred in essentially three separate periods throughout the 2 years—April to June 1995, October 1995 to January 1996, and May to August 1996—with no more instances of this opa type being isolated after November 1996. Information about sexual partners was available for 63 of the 69 patient episodes. The known transmission links within the cluster consisted of six pairs, three triplets, and 13 links to individuals with different opa types. The median number of contacts, traced and untraced, for women was 1.0 (range, 0 to 34; mean, 2.9), and that for men was 2.0 (range, 0 to 4; mean, 1.7) (Table 2). All individuals were heterosexual, and again there were significantly more women within the opa-4 cluster than in other clusters (P = 0.01 [χ² test]). The men within the opa-4 cluster were significantly more likely to be of a black ethnic group than were men within other clusters (P = 0.04 [χ² test]). The majority of individuals within the cluster had central Sheffield postcodes, which was significant compared to individuals not within the large clusters (P = 0.01 [χ² test]) (Table 2).

Recombination.The opa profiles of the isolates chosen from the clusters that were subcultured in vitro for 4 weeks were indistinguishable at each time point. Intragenic recombination or mutation affecting the opa genes of the isolates was not detected.

All isolates tested were transformable and produced rifampin-resistant colonies. Isolates of the opa-4 cluster produced a significantly higher mean number of rifampin-resistant transformants per microgram of donor DNA (P < 0.001) than isolates of the opa-1 cluster (Table 3). No spontaneous rifampin-resistant mutants occurred. Transformation using ciprofloxacin-resistant DNA as the donor again produced transformants with isolates from both clusters, with a higher mean number of transformants when DNA with a single gyrA mutation was used than when DNA with a double gyrA mutation was used. The 80 selected ciprofloxacin- and rifampin-resistant transformants (10 ciprofloxacin and rifampin transformants of each of the two cluster isolates from opa-1 and opa-4) that were auxotyped, serotyped, and opa typed showed no variation between transformants from the same experiment. The phenotypes of the transformants were the same as those of the original isolate in both auxotype and serovar. The opa profiles of the transformants were the same as those of the original isolate, either opa-1 or opa-4.

por sequencing.The por gene nucleotide sequences of the isolates with an opa-1 profile from throughout the 2-year period were identical, with no base changes (GenBank accession numbers AY297696 to AY297711 ). The amino acid sequences of the isolates with an opa-4 profile were also identical to each other, but two isolates had separate single-nucleotide changes that did not alter the encoded amino acid sequence. The opa-4 and opa-1 sequences were different from each other. The four control isolates with the same phenotype as opa-1 and opa-4 isolates (PAOU IB-2 and A IB-3, respectively) each had different por sequences from each other and from the opa type clusters.