Article Figures & Data
Figures
- FIG. 1.
Single most likely tree based on a combined analysis of the nuclear 18S rDNA and 26S rDNA of 73 ascomycetous taxa, using two basidiomycetes as outgroups. The nodes marking the Ascomycota, Euascomycetes, Archiascomycetes, and Hemiascomycetes as well as many terminal branches are supported by homogeneous Bayesian posterior probabilities ≥95%. Arrows indicate the origins of the three classes of the phylum Ascomycota. The branch length for Y. lipolytica = 0.22906 U of expected substitutions per site.
- FIG. 2.
Combined maximum likelihood analysis of six genes (ACT1, EF2, RPB1, RPB2, 18S rDNA, and 26S rDNA) for 38 taxa of Hemiascomycetes and two outgroup species, an Archiascomycete (S. pombe) and a Euascomycete (N. crassa). Thickened lines denote heterogeneous Bayesian posterior probabilities ≥95% as calculated in the combined analysis. Node numbers are indicated above each branch. Refer to Table 4 for the statistical support of each node by each gene, as well as the combined multigenic support. Branch lengths leading to Y. lipolytica (0.19157) and the outgroup taxa (0.31967) were shortened to fit the figure. Black lines on the right indicate the three clades recognized in this study.
- FIG. 3.
Diagrammatical representation of phylogram in Fig. 2 with character states for the translation of CUG (left side) and the presence or absence of Co-Q9 (right side) in the terminal taxa. The small rectangles in the center denote each species in Fig. 2. Different branch shading demarks reconstruction of ancestral character states. Black and white branches represent branches for which the presence or absence of the character could be reconstructed unambiguously with a statistical support value of ≥87%. Uncertainty in character reconstruction is indicated by gray branches (<87%).
Tables
- TABLE 1.
Taxa and DNA sequences used in this investigationa
Order or group and family Species Strain(s)b GenBank accession no.c ACT1 EF2 RPB1 RPB2 18S rDNA 26S rDNA Saccharomycetales Candidaceae Candida albicans CBS 562* AJ389057 AY497649 † AY497718 † AY497614 † AY497754 † AY497682 † Candida albicans CBS 1905 AY497580 † AY497639 † AY497708 † AY497604 † AY497744 † AY497673 † Candida castellii CBS 4332* AY497583 † AY497647 † AY497717 † AY497612 † AY497752 † AY497680 † Candida dubliniensis CBS 7987 AJ389058 AY497659 † AY497730 † AY497625 † AY497766 † AY497694 † Candida glabrata CBS 138* AJ389073 AY497636 † AY497705 † AY497601 † AY497741 † AY497670 † Candida guilliermondii MMRL 1635 AY497592 † AY497661 † AY497732 † AY497627 † AY497768 † AY497696 † Candida guilliermondii MMRL 1636 AY497593 † AY497662 † AY497733 † AY497628 † AY497769 † AY497697 † Candida guilliermondii MMRL 1759 AY497594 † AY497663 † AY497734 † AY497629 † AY497770 † AY497698 † Candida intermedia CBS 572* AY497584 † AY497650 † AY497719 † AY497615 † AY497755 † AY497683 † Candida maltosa CBS 5611 AY653540 † AY653542 † AY653536 † AY653538 † AY653544 † AY653546 † Candida norvegica CBS 4239* AY497582 † AY497646 † AY497715 † AY497611 † AY497751 † AY497679 † Candida parapsilosis ATCC 96138 AY497589 † AY497631 † AY497700 † AY497596 † AY497736 † AY497665 † Candida parapsilosis ATCC 96140 AY497590 † AY497632 † AY497701 † AY497597 † AY497737 † AY497666 † Candida parapsilosis ATCC 96144 AY497591 † AY497633 † AY497702 † AY497598 † AY497738 † AY497667 † Candida parapsilosis CBS 604* AY497585 † AY497652 † AY497722 † AY497617 † AY497758 † AY497686 † Candida tropicalis CBS 94* AY497587 † AY497660 † AY497731 † AY497626 † AY497767 † AY497695 † Candida viswanathii CBS 4024* AJ389061 AY497645 † AY497714 † AY497610 † AY497750 † AY497678 † Candida zeylanoides CBS 619* AJ389069 NDd AY497724 † AY497619 † AY497760 † AY497688 † Eremotheciaceae Eremothecium gossypii ATCC 10895 AY497588 AY497630 AY497699 AY497595 AY497735 AY497664 Metschnikowiaceae Clavispora lusitaniae CBS 6936* AJ389065 AY497655 † AY497726 † AY497621 † AY497762 † AY497690 † Clavispora opuntiae CBS 7068* AJ389067 AY497656 † AY497727 † AY497622 † AY497763 † AY497691 † Metschnikowia pulcherrima CBS 610 AJ389071 AY497653 † AY497723 † AY497618 † AY497759 † AY497687 † Saccharomycetaceae Debaryomyces carsonii CBS 2285* AY497687 † AY497643 † AY497712 † AY497608 † AY497748 † AY497676 † Debaryomyces etchellsii CBS 2011* AJ389068 AY497641 † AY497710 † AY497606 † AY497746 † U45809 Debaryomyces hansenii CBS 767 AY497586 † AY497658 † AY497729 † AY497624 † AY497765 † AY497693 † Issatchenkia orientalis CBS 573 AJ389087 AY497651 † AY497720 † AY497616 † AY497756 † AY497684 † Kluyveromyces lactis CBS 683* AJ389080 AY497654 † AY497725 † AY497620 † AY497761 † AY497689 † Kluyveromyces marxianus CBS 712* AJ389078 AY497657 † AY497728 † AY497623 † AY497764 † AY497692 † Lodderomyces elongisporus CBS 2605 AY653541 † AY653543 † AY653537 † AY653539 † AY653545 † AY653547 † Pichia fermentans CBS 1876 AJ389083 AY497638 † AY497707 † AY497603 † AY497743 † AY497672 † Pichia guilliermondii CBS 2030* AJ389063 AY497642 † AY497711 † AY497607 † AY497747 † AY497675 † Pichia jadinii CBS 1600* AJ389090 AY497637 † AY497706 † AY497602 † AY497742 † AY497671 † Pichia membranifaciens CBS 107* AJ389088 AY497634 † AY497703 † AY497599 † AY497739 † AY497668 † Pichia norvegensis CBS 1922 AJ389085 AY497640 † AY497709 † AY497605 † AY497745 † AY497674 † Saccharomyces cerevisiae CBS 1177* AJ389075 AY497635 † AY497704 † AY497600 † AY497740 † AY497669 † Saccharomyces kluyveri CBS 3082* AJ389077 AY497644 † AY497713 † AY497609 † AY497749 † AY497677 † Dipodascaceae Stephanoascus ciferrii CBS 4856* ND AY497648 † AY497718 † AY497613 † AY497753 † AY497681 † Yarrowia lipolytica CBS 599 ND ND AY497721 † ND AY497757 † AY497685 † Outgroup for phylogenetic analysis of the Hemiascomycetes Schizosaccharomycetaceae Schizosaccharomyces pombe Y00447 D83976 X56564 D13337 L20414 U40085 Sordiariaceae Neurospora crassa U78026 AF258620 AABX01000048.1 AF107789 X04971 AF266411 Euascomycota Arthrodermataceae Arthroderma benhamiae AY083233.1 ND Arthroderma ciferrii AB015769.2 AB04068.1 Cochliobolus Curvularia brachyspora L36995 AF279380 Cudoniaceae Cudonia circinans AF1074343 AF279379 Discinaceae Gyromitra esculenta U42648 AY640952 Dothideaceae Dothidea insculpta U42474 AY640949 Gyalectaceae Gyalecta ulmi AF465464 AF465463 Herpotrichiellaceae Capronia pilosella U42473 AF279377 Exophiala jeanselmei X80705 AF050271 Morchellaceae Morchella esculenta U42642 AF279398 Neolectaceae Neolecta irregularis Z47721 AF279401 Onygenaceae Ajellomyces capsulatus AF320009 AF071952 Coccidioides immitis M55627 AB040702 Paracoccidioides brasiliensis AF22751 U81263.1 Peltigeraceae Peltigera canina AF356681 AF286822 Peltulaceae Peltula obscurans AF356692 AF356693 Pezizaceae Peziza quelepidotia AY640999 AY640959 Rhytismataceae Rhytisma acerinum AF356695 AF356696 Rocellaceae Dendrographa minor AF279381 AF279383 Stereocaulaceae Stereocaulon paschale AF279412 AF279413 Taphrinaceae Taphrina pruni AB000956 Z49792 Trichocomaceae Aspergillus fumigatus AF397059.1 AJ438344 Emericella nidulans AB008403 AF109337 Hamigera avellanea D14406 AB000620 Penicillium chrysogenum AF411201.1 AF034857 Penicillium freii AY640998 AY640958 Penicillium viridicatum AY083222.1 AF003358.1 Umbilicariaceae Lasallia pensylvanica AF356664 AF356665 Valsaceae Diaporthe phaseolorum L36985 U47830 Verrucariaceae Dermatocarpon luridum AY640989 AY640948 Verrucaria pachyderma AF356667 AF356668 Xylariaceae Seynesia erumpens AF279409 AF279410 Outgroup for phylogenetic analysis of Ascomycota Corticiacaea Athelia bombacina M55638 AF279377 Psathyrellaceae Coprinus cinereus M92991 AF041494 ↵ a The nomenclature was taken from Kurtzman and Fell (23) (Hemiascomycetes) or the National Center for Biotechnology Information TaxBrowser (Euascomycota) (www.ncbi.nlm.nih.gov/Taxonomy/taxonomyhome.html ).
↵ b ATCC, American Type Culture Collection; CBS, Centraalbureau vor Schimmelcultures; MMRL, Medical Mycological Research Laboratory, Wiley Schell, Duke University Medical Center.
↵ c *, type strain. †, sequences were generated as part of this study.
↵ d ND, no data available.
- TABLE 2.
Primers used for PCR and cycle sequencing
Gene Primer Sequence (5′ → 3′) Positiona Reference or sourceb EF2 EFIIF1 AAGTCTCCAAACAAAGCATAAC 2983-3005 This study EFIIR2 GGGAAAGCTTGACCACCAGTAGC 3602-3625 This study EFII3F TGAAAATGGTGTCATTAACC 3054-3074 This study EFII4R TTCGTTAACTGGCAAGTAAG 3551-3571 This study ACT1 ACT1 TACCCAATTGAACACGGTAT 1996-2015 This study ACT2 TCTGAATCTTTCGTTACCAAT 2575-2595 This study ACT1-2F TACAACGAATTGAGAGTTGC 728-745 This study ACT1-2R GAAGAAGTTTGCATTTCTTG 1329-1349 This study RPB1 Af GARTGYCCDGGDCAYTTYGC 224-244 B. Hall Cr CCNGCDATNTCRTTRTCCATRTA 951-974 B. Hall RPB2 RPB2-5F GAYGAYMGWGATCAYTTYGG 1159-1179 29 RPB2-1014R CCRCAIGCYTGICCYTCDGG 994-1014 F. Lutzoni RPB2-7R CCCATWGCYTGCTTMCCCAT 2349-2369 29 RPB2-980F TCYCCIGCIGARACICCHGARGG 980-1003 F. Lutzoni 18S rDNA nSSU 131 CAGTTATCGTTTATTTGATAGTACC 125-150 15 NS3 GCAAGTCTGGTGCCAGCAGCC 598-619 48a NS1 GTAGTCATATGCTTGTCTC 20-38 48a NS22 AATTAAGCAGACAAATCACT 1307-1327 R. Vilgalys SR4 AAACCAACAAAATAGAA 820-838 R. Vilgalys 26S rDNA LROR ACCCGCTGAACTTAAGC 26-42 R. Vilgalys LR5 TCCTGAGGGAAACTTCG 948-964 R. Vilgalys LR7 TACTACCACCAAGATCT 1448-1432 R. Vilgalys LR2R AAGAACTTTGAAAAGAG 374-389 R. Vilgalys LR3 CCGTGTTTCAAGACGGG 651-635 R. Vilgalys ↵ a Position of the primer relative to C. albicans or S. cerevisiae (in italics). ND, no data available.
↵ b URLs for sources are as follows: B. Hall, http://faculty.washington.edu/benhall/ ; F. Lutzoni, http://www.lutzonilab.net/pages/primer.shtml ; R. Vilgalys, http://www.biology.duke.edu/fungi/mycolab/primers.html .
- TABLE 3.
Overview of evolutionary substitution models applied to combined- and single-gene analyses and to different codon positions in the protein-coding genes
Fungal data set Substitution models applied to single or combined genes Substitution models applied to different codon positions of a gene Gene(s) Alignment length (bp) Modela Gene Codon position(s) Modela Ascomycota 18S and 26S rDNA 3,057 TrN+I+G RPB1 1 and 2 TrN+G Saccharomycetales 6 genes 5,064 TrN+I+G RPB1 3 TVM+I+G RPB1 825 TrNef+I+G RPB2 1 and 2 TVM+I+G RPB2 1,238 TrN+I+G RPB2 3 GTR+I+G ACT1 489 GTR+I+G ACT1 1 and 2 JC+G EF2 603 TrN+G ACT1 3 GTR+I+G 18S rDNA 1,149 TrN+I+G EF2 1 and 2 TVM+I+G 26S rDNA 760 TIM+I+G EF2 3 TIM+I+G ↵ a I, proportion of invariable sites; G, gamma distribution; TrN, Tamura-Nei variable base frequencies (46); TrNef, Tamura-Nei equal transversion frequencies (46); GTR, general time reversible (26, 41, 47); TIM, transition model; TVM, transversion model; JC, Jukes-Cantor model (13).
- TABLE 4.
Single-gene posterior probabilities for nodes in the combined analysis of the Saccharomycetales shown in Fig. 2
Group Node Posterior probabilitya Single-gene analyses Combined analysis (28) ACT1 (8) EF2 (10) RPB1 (18) RPB2 (15) 18S rDNA (10) 26S rDNA (10) 1 <0.01 <0.01 <0.01 <0.01 1.00 <0.01 <0.01 2 1.0 1.00 1.00 0.31 0.77 1.00 1.00 3 <0.01 <0.01 <0.01 0.89 0.33 <0.01 0.68 Clade 3 4 <0.01 <0.01 0.42 0.50 0.76 <0.01 1.00 5 <0.01 1.00 1.00 1.00 1.00 1.00 1.00 6 <0.01 0.88 <0.01 0.54 <0.01 <0.01 0.86 7 <0.01 <0.01 0.69 1.00 <0.01 <0.01 1.00 8 0.99 1.00 1.00 1.00 0.95 0.33 1.00 9 <0.01 0.66 1.00 1.00 0.94 0.48 1.00 10 <0.01 <0.01 1.00 0.90 0.99 0.68 1.00 11 1.0 0.31 1.00 1.00 1.00 1.00 1.00 12 0.29 <0.01 0.77 0.16 <0.01 0.39 0.63 13 <0.01 <0.01 1.00 1.00 <0.01 0.59 1.00 14 <0.01 <0.01 <0.01 <0.01 0.25 0.64 0.31 15 <0.01 <0.01 0.94 <0.01 0.78 <0.01 0.96 Clade 2 16 <0.01 <0.01 0.94 0.43 <0.01 <0.01 0.96 17 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 0.88 18 <0.01 <0.01 <0.01 0.83 <0.01 <0.01 0.55 19 <0.01 0.34 <0.01 <0.01 <0.01 <0.01 0.85 20 <0.01 <0.01 0.98 <0.01 <0.01 <0.01 0.75 21 <0.01 <0.01 1.00 1.00 <0.01 1.00 1.00 22 <0.01 <0.01 0.48 0.99 1.00 0.64 1.00 23 <0.01 <0.01 <0.01 <0.01 1.00 0.62 1.00 24 0.21 <0.01 <0.01 0.28 0.97 <0.01 0.73 25 1.00 1.00 1.00 1.00 1.00 1.00 1.00 26 <0.01 0.78 0.74 1.00 0.20 0.20 1.00 27 0.20 1.00 0.97 1.00 0.20 0.20 1.00 28 <0.01 1.00 0.99 0.32 0.47 <0.01 0.96 Clade 1 29 <0.01 <0.01 0.85 0.51 1.00 0.98 1.00 30 1.00 <0.01 1.00 0.51 <0.01 0.99 1.00 31 0.75 0.98 0.18 0.51 <0.01 0.97 1.00 32 0.24 0.33 0.62 0.93 0.20 0.40 1.00 33 0.99 1.00 1.00 0.51 0.20 1.00 1.00 34 0.40 <0.01 1.00 1.00 <0.01 <0.01 1.00 35 0.19 0.79 <0.01 0.92 <0.01 <0.01 1.00 36 0.36 <0.01 1.00 1.00 <0.01 0.34 1.00 37 1.00 1.00 1.00 1.00 <0.01 1.00 1.00 38 1.00 0.98 1.00 1.00 <0.01 0.84 1.00 ↵ a Significant nodes are shown in bold. The total numbers of significant nodes are shown in parentheses.
