Article Figures & Data
Tables
- TABLE 1.
Regions of homology with primer pair p289-p290 of the RNA-dependent RNA polymerase gene of caliciviruses representative of Norovirus genogroups I and II, Sapovirus, and selected rotavirus strainsa
Strainb Primer 290 GATTACTCCAAGTGGGACTCCAC Primer 289 TATGGTGATGATTACATTGTCA Location RT-PCR reactivityc NORWALK -----TA-AGCA--------A--ACAAAA ATTT--------------G-G-----GT 4568-4886 + HAWAII -----T--TCGA--------A--ACAGCA TTTC--------------G-A-----G- + HOUSTON/86 -----------A-----------ACAAAA CACACG-----------C-G---GTA-- + UK ATA---G---G--ATA-TA----CAGTGA CTATCT----------T-ACACGCT-TT 1314-1547 + YM ATA-------G---TT-TA--T-CAGTAA TTGTCA--------C-T-ACG-GAT-TT + KU -TA-------G---TT-T---T-CAGTGA TTATCA--C-------T-ACG-GAT-TT NT SA11 ATAC--G--TG--ATA-TA----CAGTGA TTGTCA--C--C----TAACGCG-T-TT − ↵ a Sequence alignments were made by using the program DNAman, version 5.2.2 (Lynnon, Bio Soft, Quebec, Canada).
↵ b Norwalk, Hu/NV/GI/Norwalk/1968/US, GenBank accession no. M87661 ; Hawaii, Hu/NV/GII/Hawaii/1971/US, GenBank accession no. U07661 ; Houston/86, Hu/SV/Houston/1986/US, GenBank accession no. U65427 ; UK, bovine rotavirus strain, GenBank accession no. X55444 ; YM, porcine rotavirus strain, GenBank accession no. X76486 ; KU, human rotavirus strain, GenBank accession no. AB022765 ; SA11, simian rotavirus strain, GenBank accession no. X16830 . The locations of the primers in the genome are based on the sequence of the full-length Norwalk genome and the complete sequence of UK VP1.
↵ c +, reactive by RT-PCR; −, nonreactive by RT-PCR; NT, not tested.