Skip to main content
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems
  • Log in
  • My alerts
  • My Cart

Main menu

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About JCM
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems

User menu

  • Log in
  • My alerts
  • My Cart

Search

  • Advanced search
Journal of Clinical Microbiology
publisher-logosite-logo

Advanced Search

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About JCM
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
Virology

Primer Pair p289-p290, Designed To Detect Both Noroviruses and Sapoviruses by Reverse Transcription-PCR, Also Detects Rotaviruses by Cross-Reactivity

Juan E. Ludert, Ana C. Alcalá, Ferdinando Liprandi
Juan E. Ludert
Centro de Microbiología y Biología Celular, Instituto Venezolano de Investigaciones Científicas (IVIC), Caracas, Venezuela
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: jeludert@ivic.ve
Ana C. Alcalá
Centro de Microbiología y Biología Celular, Instituto Venezolano de Investigaciones Científicas (IVIC), Caracas, Venezuela
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Ferdinando Liprandi
Centro de Microbiología y Biología Celular, Instituto Venezolano de Investigaciones Científicas (IVIC), Caracas, Venezuela
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
DOI: 10.1128/JCM.42.2.835-836.2004
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Article Figures & Data

Tables

  • TABLE 1.

    Regions of homology with primer pair p289-p290 of the RNA-dependent RNA polymerase gene of caliciviruses representative of Norovirus genogroups I and II, Sapovirus, and selected rotavirus strainsa

    StrainbPrimer 290 GATTACTCCAAGTGGGACTCCACPrimer 289 TATGGTGATGATTACATTGTCALocationRT-PCR reactivityc
    NORWALK -----TA-AGCA--------A--ACAAAA ATTT--------------G-G-----GT 4568-4886+
    HAWAII -----T--TCGA--------A--ACAGCA TTTC--------------G-A-----G- +
    HOUSTON/86 -----------A-----------ACAAAA CACACG-----------C-G---GTA-- +
    UK ATA---G---G--ATA-TA----CAGTGA CTATCT----------T-ACACGCT-TT 1314-1547+
    YM ATA-------G---TT-TA--T-CAGTAA TTGTCA--------C-T-ACG-GAT-TT +
    KU -TA-------G---TT-T---T-CAGTGA TTATCA--C-------T-ACG-GAT-TT NT
    SA11 ATAC--G--TG--ATA-TA----CAGTGA TTGTCA--C--C----TAACGCG-T-TT −
    • ↵ a Sequence alignments were made by using the program DNAman, version 5.2.2 (Lynnon, Bio Soft, Quebec, Canada).

    • ↵ b Norwalk, Hu/NV/GI/Norwalk/1968/US, GenBank accession no. M87661 ; Hawaii, Hu/NV/GII/Hawaii/1971/US, GenBank accession no. U07661 ; Houston/86, Hu/SV/Houston/1986/US, GenBank accession no. U65427 ; UK, bovine rotavirus strain, GenBank accession no. X55444 ; YM, porcine rotavirus strain, GenBank accession no. X76486 ; KU, human rotavirus strain, GenBank accession no. AB022765 ; SA11, simian rotavirus strain, GenBank accession no. X16830 . The locations of the primers in the genome are based on the sequence of the full-length Norwalk genome and the complete sequence of UK VP1.

    • ↵ c +, reactive by RT-PCR; −, nonreactive by RT-PCR; NT, not tested.

PreviousNext
Back to top
Download PDF
Citation Tools
Primer Pair p289-p290, Designed To Detect Both Noroviruses and Sapoviruses by Reverse Transcription-PCR, Also Detects Rotaviruses by Cross-Reactivity
Juan E. Ludert, Ana C. Alcalá, Ferdinando Liprandi
Journal of Clinical Microbiology Feb 2004, 42 (2) 835-836; DOI: 10.1128/JCM.42.2.835-836.2004

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Print

Alerts
Sign In to Email Alerts with your Email Address
Email

Thank you for sharing this Journal of Clinical Microbiology article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Primer Pair p289-p290, Designed To Detect Both Noroviruses and Sapoviruses by Reverse Transcription-PCR, Also Detects Rotaviruses by Cross-Reactivity
(Your Name) has forwarded a page to you from Journal of Clinical Microbiology
(Your Name) thought you would be interested in this article in Journal of Clinical Microbiology.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
Primer Pair p289-p290, Designed To Detect Both Noroviruses and Sapoviruses by Reverse Transcription-PCR, Also Detects Rotaviruses by Cross-Reactivity
Juan E. Ludert, Ana C. Alcalá, Ferdinando Liprandi
Journal of Clinical Microbiology Feb 2004, 42 (2) 835-836; DOI: 10.1128/JCM.42.2.835-836.2004
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Top
  • Article
    • ABSTRACT
    • ACKNOWLEDGMENTS
    • FOOTNOTES
    • REFERENCES
  • Figures & Data
  • Info & Metrics
  • PDF

KEYWORDS

DNA Primers
norovirus
Reverse Transcriptase Polymerase Chain Reaction
rotavirus
sapovirus

Related Articles

Cited By...

About

  • About JCM
  • Editor in Chief
  • Board of Editors
  • Editor Conflicts of Interest
  • For Reviewers
  • For the Media
  • For Librarians
  • For Advertisers
  • Alerts
  • RSS
  • FAQ
  • Permissions
  • Journal Announcements

Authors

  • ASM Author Center
  • Submit a Manuscript
  • Article Types
  • Resources for Clinical Microbiologists
  • Ethics
  • Contact Us

Follow #JClinMicro

@ASMicrobiology

       

ASM Journals

ASM journals are the most prominent publications in the field, delivering up-to-date and authoritative coverage of both basic and clinical microbiology.

About ASM | Contact Us | Press Room

 

ASM is a member of

Scientific Society Publisher Alliance

 

American Society for Microbiology
1752 N St. NW
Washington, DC 20036
Phone: (202) 737-3600

 

Copyright © 2021 American Society for Microbiology | Privacy Policy | Website feedback

Print ISSN: 0095-1137; Online ISSN: 1098-660X