Skip to main content
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems
  • Log in
  • My alerts
  • My Cart

Main menu

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About JCM
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems

User menu

  • Log in
  • My alerts
  • My Cart

Search

  • Advanced search
Journal of Clinical Microbiology
publisher-logosite-logo

Advanced Search

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About JCM
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
Bacteriology

Multiplex PCR Assay for Direct Identification of Group B Streptococcal Alpha-Protein-Like Protein Genes

Roberta Creti, Francesca Fabretti, Graziella Orefici, Christina von Hunolstein
Roberta Creti
Laboratorio di Batteriologia, Istituto Superiore di Sanità, 00161 Rome, Italy
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: roberta.creti@iss.it
Francesca Fabretti
Laboratorio di Batteriologia, Istituto Superiore di Sanità, 00161 Rome, Italy
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Graziella Orefici
Laboratorio di Batteriologia, Istituto Superiore di Sanità, 00161 Rome, Italy
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Christina von Hunolstein
Laboratorio di Batteriologia, Istituto Superiore di Sanità, 00161 Rome, Italy
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
DOI: 10.1128/JCM.42.3.1326-1329.2004
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Article Figures & Data

Figures

  • Tables
  • FIG. 1.
    • Open in new tab
    • Download powerpoint
    FIG. 1.

    Amino acid multisequence alignment of the N-terminal portions of S. agalactiae alpha-C protein, Alp2, Alp3, Rib, and the epsilon protein. The nucleotide sequence corresponding to the string from positions 11 to 17, indicated in grey, was used as the forward universal primer. The reverse primers sequences, specific for each protein gene (except for Alp2/3), are also indicated in grey.

  • FIG. 2.
    • Open in new tab
    • Download powerpoint
    FIG. 2.

    Gel electrophoresis of multiplex PCR amplification products. Direct analysis of amplicon size allowed the determination of the genes encoding the surface protein of each GBS strain as follows: Rib (lanes 1, 2, and 8), alpha-C protein (lanes 3 and 10), Alp2/3 (lanes 4, 6, 9, and 12), Alp4 (lane 7), and the epsilon protein (lanes 5 and 1l). Lane 13 is the negative control. M, 2-log DNA ladder (0.1 to 10.0 kb; New England Biolabs, Inc.).

Tables

  • Figures
  • TABLE 1.

    Nucleotide primer sequences and amplicon size expected for each S. agalactiae surface protein gene considered in this study

    PrimerSequence (5′-3′)GenBank accession no.Position from start codon (nt)aAmplicon size (bp)
    Universal forwardTGATACTTCACAGACGAAACAACG30
    Alpha-C reverseTACATGTGGTAGTCCATCTTCACCM97256428398
    Rib reverseCATACTGAGCTTTTAAATCAGGTGAU583333325295
    Epsilon reverseCCAGATACATTTTTTACTAAAGCGGU33554230200
    Alp2/3 reverseCACTCGGATTACTATAATATTTAGCACAF208158364334
    Alp4 reverseTTAATTTGCACCGGATTAACACCACAJ488912140110
    • ↵a nt, nucleotides.

  • TABLE 2.

    Characteristics of GBS strains used in this study

    Strain or isolateSerotypeAlpha-protein-like proteina
    Reference strains
        NCTC 11078 (A909)Ia/CAlpha
        090IaAlp2b
        NCTC 8187 (H36B)Ib/CAlpha
        M 781III/RRib
        Prague 1/82IVEpsilon
        Prague 10/84VNegative
        Prague 118754VIEpsilon
        Prague 7271VIIEpsilon
        JM9-130013VIII/RAlp3b
        NCTC 9828NT/RAlp4
    Clinical isolates
        1319IaEpsilon
        1325IaEpsilon
        2129IbAlpha
        5518IbAlpha
        2088Ia/CEpsilon
        5551Ia/CAlpha
        1599Ib/CAlpha
        1977Ib/CAlpha
        5401IIAlpha
        3050IIRib
        2452II/CEpsilon
        5405II/CAlpha
        2448II/RRib
        2141II/RRib
        5368IIIRib
        5435IIIRib
        5400IIIAlp2b
        1056III/CEpsilon
        1496III/CEpsilon
        2601III/CAlpha
        4383III/RRib
        1998III/RRib
        1999IVEpsilon
        2274IVAlpha
        1613IVEpsilon
        2273IVAlpha
        2620IVEpsilon
        2102VEpsilon
        2361VII/RAlp3b
        2362VII/RAlp3b
        5408VIIIAlp2b
        2179VIII/CEpsilon
        1715VIII/RRib
        2198VIII/RRib
        2442VIII/RAlp2b
        2925NTAlpha
        2933NTAlpha
        2450NTAlpha
        2927NTAlpha
        3002NTRib
        2277NT/CAlpha
        2914NT/CEpsilon
        2116NT/RRib
        5366NT/RRib
    Bovine strains
        3492IIIEpsilon
        3491IVEpsilon
        3476IVEpsilon
        3477IVEpsilon
        3479NTEpsilon
        3485NTEpsilon
        3487NT/CAlpha
        3490NTEpsilon
        3488NTNegative
        2628VRib
        2068VAlp3b
        2110V/CEpsilon
        2929V/CAlpha
        5403V/RRib
        1989VIEpsilon
        1992VIEpsilon
        1990VI/CEpsilon
        1994VI/CEpsilon
        1272VII/CAlpha
        2928VII/C
    • ↵a The designation of the alpha-protein-like protein encoded by the gene is based both on PCR results and sequencing of the PCR product.

    • ↵b The differentiation between the proteins encoded by the alp2 and alp3 genes was performed by sequencing entire genes as described in reference 10.

PreviousNext
Back to top
Download PDF
Citation Tools
Multiplex PCR Assay for Direct Identification of Group B Streptococcal Alpha-Protein-Like Protein Genes
Roberta Creti, Francesca Fabretti, Graziella Orefici, Christina von Hunolstein
Journal of Clinical Microbiology Mar 2004, 42 (3) 1326-1329; DOI: 10.1128/JCM.42.3.1326-1329.2004

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Print

Alerts
Sign In to Email Alerts with your Email Address
Email

Thank you for sharing this Journal of Clinical Microbiology article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Multiplex PCR Assay for Direct Identification of Group B Streptococcal Alpha-Protein-Like Protein Genes
(Your Name) has forwarded a page to you from Journal of Clinical Microbiology
(Your Name) thought you would be interested in this article in Journal of Clinical Microbiology.
Share
Multiplex PCR Assay for Direct Identification of Group B Streptococcal Alpha-Protein-Like Protein Genes
Roberta Creti, Francesca Fabretti, Graziella Orefici, Christina von Hunolstein
Journal of Clinical Microbiology Mar 2004, 42 (3) 1326-1329; DOI: 10.1128/JCM.42.3.1326-1329.2004
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Top
  • Article
    • ABSTRACT
    • ACKNOWLEDGMENTS
    • FOOTNOTES
    • REFERENCES
  • Figures & Data
  • Info & Metrics
  • PDF

Related Articles

Cited By...

About

  • About JCM
  • Editor in Chief
  • Board of Editors
  • Editor Conflicts of Interest
  • For Reviewers
  • For the Media
  • For Librarians
  • For Advertisers
  • Alerts
  • RSS
  • FAQ
  • Permissions
  • Journal Announcements

Authors

  • ASM Author Center
  • Submit a Manuscript
  • Article Types
  • Resources for Clinical Microbiologists
  • Ethics
  • Contact Us

Follow #JClinMicro

@ASMicrobiology

       

ASM Journals

ASM journals are the most prominent publications in the field, delivering up-to-date and authoritative coverage of both basic and clinical microbiology.

About ASM | Contact Us | Press Room

 

ASM is a member of

Scientific Society Publisher Alliance

Copyright © 2019 American Society for Microbiology | Privacy Policy | Website feedback

Print ISSN: 0095-1137; Online ISSN: 1098-660X