Article Figures & Data
Figures
- FIG. 1.
PCR analysis of PCR profiles for P. marneffei ATCC 64102. Analyses for PMM I (A) and PMM II (B) were performed with a FAM-labeled primer; analysis for PMM III (C) was performed with a primer labeled with HEX. The number above the peak refers to the size of the PCR amplification product.
- FIG. 2.
Allele size distributions for PMM I (A), PMM II (B), and PMM III (C) for 35 P. marneffei isolates.
- FIG. 3.
Allele size distributions for PMM I (A), PMM II (B), and PMM III (C) for 12 P. marneffei clinical isolates obtained from China (▪) and 16 clinical isolates obtained from Thailand (□).
Tables
- TABLE 1.
P. marneffei isolates, isolate sources, and genotypes determined by PMM analysis
Isolatea Source Geographic location PMM type ATCC 64101* Human China 1 ATCC 64102* Rat China 2 NCPF 4090 Human Hong Kong 3 NCPF 4147 Human Not known 4 NCPF 4157 Human Thailand 4 NCPF 4158 Human Thailand 5 NCPF 4176 Human Not known 6 B-6317 Human China 7 B-6318 Human China 8 B-6319 Human China 7 B-6320 Human China 7 B-6321 Human China 7 B-6322 Human China 9 B-6323 Human China 10 B-6324* Human China 11 B-6325 Human China 12 B-6326 Human China 12 ATCC 201564 Soil Thailand 13 ATCC 24100 Human Not known 14 ATCC 58950 Human Not known 15 ATCC 200050 Human Thailand 13 ATCC 200051 Human Thailand 16 ATCC 201013* Human Thailand 13 ATCC 18224 Rat Vietnam 17 IFM 47279* Human Thailand 19 IFM 47280 Human Thailand 13 IFM 47281 Human Thailand 13 IFM 47282 Human Thailand 18 IFM 47284* Human Thailand 20 IFM 47285 Human Thailand 13 IFM 47286* Human Thailand 21 IFM 47287 Human Thailand 22 IFM 47288* Human Thailand 16 IFM 47289* Human Thailand 13 ATCC 56573 Human Not known 6 ↵ a Isolates used to evaluate PMM stability are indicated by an asterisk.
- TABLE 2.
Characteristics of three polymorphic microsatellite markers of P. marneffei
Microsatellite GenBank accession no. Microsatellite sequencea Primer sequences (5′ to 3′) Range of PCR (bp) No. of alleles I AL684924 (GA)7AC(GA)22 AGTAGTTCATCGGCCGAA 172-266 14 GTACCCTTCAAGGTGGTA II AL686035 (CA)7TA(CA)7 AGCTGGAACTGCACCTCTGA 136-157 8 CTTTTGGAGCTGGGTCTGCA III AL684847 (CA)6TA(CA)6 CTATGCCGGGAAGGCAGTGA 206-226 7 ACCCTACGCACTAGACGGAA ↵ a Based on P. marneffei strain PM1.
