Article Figures & Data
Figures
- FIG. 1.
Relatedness of 42 MRSA strains between different typing methods. *, strains CH 69, IPO1M2046, and 14176-5710 belonged to spa types t1963, t1958, and t1959, respectively, which have not been previously deposited in the database.
- FIG. 2.
The 13 toxin gene profiles of the 41 strains. Lanes 1 to 42 show results for the following isolates, in order (see Table 1): FH43, SJOG 30, RPH85, B827549, SN39, RHH58, RHH10, FH53, B8-10, RPH2, IMVS67, CH16, CH69, PAH58, PAH1, E822485, J710566, RPH74, E804531, CH97, IP01M2046, C801535, F829549, RBH98, 13792-4492, IP01M1081, 14176-5710, K704540, K711532, AH13, RDH81, AH1, RPAH18, RPAH15, COL, MW2, DEN2988, BK2464, HDG2, HU25, a control strain, and ANS46.
Tables
- TABLE 1.
Genotypes and spa types of 42 well-characterized methicillin-resistant S. aureus isolates used in this study
Strain GenBank accession no.a Defined spa lengthb spa typec spa profilec Clonal typed, e Sources of Australian isolatesh B827549 EF094508 134 t1784 07-34-33-13 ST∼1-SCCmec-new QHPS HU25g EF094528 182 t138 08-16-02-25-17-24 ST239-SCCmec-IIIA HDG2g EF094527 182 t421 15-12-16-02-25-17 ST239-SCCmec-IIIB K704540f EF094525 206 t037 15-12-16-02-25-17-24 ST∼239-SCCmec-III QHPS K711532f = EF094525 206 t037 15-12-16-02-25-17-24 ST∼239-SCCmec-III QHPS AH13f = EF094525 206 t037 15-12-16-02-25-17-24 ST239-SCCmec-IIIA AGAR RDH81f = EF094525 206 t037 15-12-16-02-25-17-24 ST239-SCCmec-IIIA AGAR AH1f = EF094525 206 t037 15-12-16-02-25-17-24 ST128-SCCmec-IIIA AGAR RPAH 18f = EF094525 206 t037 15-12-16-02-25-17-24 ST239-SCCmec-III AGAR RPAH15f = EF094525 206 t037 15-12-16-02-25-17-24 ST239-SCCmec-III AGAR ANS46g = EF094525 206 t037 15-12-16-02-25-17-24 ST239-SCCmec-III PC8f EF094507 206 t127 07-23-21-16-34-33-13 ST1-SCCmec-IV AGAR FH43f = EF094507 206 t127 07-23-21-16-34-33-13 ST∼1-SCCmec-IV AGAR SJOG 30f = EF094507 206 t127 07-23-21-16-34-33-13 ST1-SCCmec-IV AGAR RPH 85f = EF094507 206 t127 07-23-21-16-34-33-13 ST∼1-SCCmec-IV AGAR SN39f = EF094507 206 t127 07-23-21-16-34-33-13 ST∼1-SCCmec-new AGAR RHH58f = EF094507 206 t127 07-23-21-16-34-33-13 ST∼1-SCCmec-IV AGAR RHH10f = EF094507 206 t127 07-23-21-16-34-33-13 ST∼1-SCCmec-IV AGAR FH53f = EF094507 206 t127 07-23-21-16-34-33-13 ST∼1-SCCmec-I AGAR RPH2f EF094510 206 t190 11-17-34-24-34-22-25 ST8-SCCmec-new AGAR PAH 58f EF094514 230 t019 08-16-02-16-02-25-17-24 ST30-SCCmec-IV AGAR PAH 1f = EF094514 230 t019 08-16-02-16-02-25-17-24 ST30-SCCmec-IV AGAR MW2g EF094526 230 t128 07-23-23-21-16-34-33-13 ST1-SCCmec-IV RBH98f EF094522 230 t202 11-17-23-17-17-16-16-25 ST93-SCCmec-IV AGAR 13792-4492f = EF094522 230 t202 11-17-23-17-17-16-16-25 ST∼93-SCCmec-IV QHPS IP01M1081f EF094523 230 t216 04-20-17-20-17-31-16-34 ST59-SCCmec-IV QHPS 14176-5710f EF094524 230 t1959c 15-21-12-16-02-25-17-16 ST∼239-SCCmec-III QHPS B8-10f EF094509 230 t711 04-21-17-34-24-34-22-25 ST∼8-SCCmec-IV QHPS J710566f EF094516 254 t065 09-02-16-34-13-17-34-16-34 ST45-SCCmec-V QHPS RPH 74f EF094517 254 t123 09-02-16-34-13-16-34-16-34 ST45-SCCmec-V AGAR IP01M2046f EF094519 254 t1958c 08-21-17-13-13-new-34-33-34 ST78-SCCmec-IV QHPS E804531f EF094518 278 t002 26-23-17-34-17-20-17-12-17-16 ST5-SCCmec-IV QHPS CH97f = EF094518 278 t002 26-23-17-34-17-20-17-12-17-16 ST73-SCCmec-IV AGAR BK2464g = EF094518 278 t002 26-23-17-34-17-20-17-12-17-16 ST5-SCCmec-II IMVS 67f EF094511 278 t008 11-19-12-21-17-34-24-34-22-25 ST8-SCCmec-V AGAR COLg = EF094511 278 t008 11-19-12-21-17-34-24-34-22-25 ST250-SCCmec-I DEN2988g = EF094511 278 t008 11-19-12-21-17-34-24-34-22-25 ST8-SCCmec-IVA F829549f EF094521 278 t186 07-12-21-17-13-13-34-34-33-34 ST88-SCCmec-IV QHPS C801535f EF094520 278 t325 07-12-21-17-34-13-34-34-33-34 ST88-SCCmec-new QHPS E822485f EF094515 302 t018 15-12-16-02-16-02-25-17-24-24-24 ST36-SCCmec-II QHPS CH69f EF094513 326 t1963c 26-23-13-17-31-29-17-25-17-25-16-28 ST∼22-SCCmec-IV AGAR CH16f EF094512 422 t032 26-23-23-13-23-31-29-17-31-29-17-25-17-25-16-28 ST22-SCCmec-IV AGAR ↵ a The relevant spa sequences have been submitted to GenBank; other strains with identical spa sequences are indicated by “=” and the accession no. for the corresponding submitted GenBank sequence.
↵ b Defined spa lengths are the distances from the start and end points, equal to 1156 and 1481 in GenBank sequence J01786, which correlates with the start and end point of the suggested 5′ and 3′ signature sequences (www.spaServer.Ridom.de ). The full repetitive region sequence length can be calculated by adding together the lengths of sequences of individual repeats.
↵ c After comparison with spa database (www.spaServer.Ridom.de ) and GenBank sequences, three new spa types sequences were identified and submitted to the spa database (www.spaServer.Ridom.de ). Please refer to the spa database for spa type and profile nomenclature.
↵ d ST, MLST; SCCmec, staphylococcal cassette chromosome mec. Information provided by strain donors; ST∼, single nucleotide polymorphism type as described by Huygens et al. (18) using the computer program Minimum SNPs to compare with existing MLST data (17).
↵ e Clonal type refers to the combination of ST and SCCmec type.
↵ f Thirty-five Australian strains were provided by Philip Giffard, Cooperative Research Centre for Diagnostics, Queensland University of Technology, Brisbane, Australia, and Graeme Nimmo, Queensland Health Pathology Services, Princess Alexandra Hospital, Brisbane, and have been used in several previous studies (17, 18, 40).
↵ g Seven isolates were provided by Herminia de Lencastre, Instituto de Tecnologia Química e Biológica, Universidade Nova de Lisboa, Oeiras, Portugal, and have been used in several previous studies (33, 34); spa types identified in this study were identical with those previously reported for these strains (de Lencastre, personal communication).
↵ h QHPS, Queensland Health Pathology Service (isolates from various diagnostic laboratories in Queensland); AGAR, Australian Group on Antibiotic Resistance (isolates from a study of community MRSA in Australia) (6).
- TABLE 2.
Primers and probes used in mPCR/RLB for detection of 13 toxin genes
Primer/probea Target Tm °Cb GenBank accession no. Primer/probe sequence (5′-3′)c Referencesd nucSb nuc 65.68 V01281 511GCG ATT GAT GGT GAT ACG GTT531 7 nucAp nuc 61.36 V01281 558CAT TGG TTG ACC TTT GTA CAT TAA 535 This study nucSp nuc 61.06 V01281 745GAT GGA AAA ATG GTA AAC GAA G766 This study nucAb nuc 69.12 V01281 789AGC CAA GCC TTG ACG AAC TAA AGC766 7 seaSb sea 64.05 M18970 487CCT TTG GAA ACG GTT AAA ACG507 3 seaSp sea 68.83 M18970 531GGA GTT GGA TCT TCA AGC AAG ACG 554 3 seaAp sea 63.87 M18970 613TCT GAA CCT TCC CAT CAA AAA C592 3 seaAb sea 62.91 M18970 691 TTGA ATA CTG TCC TTG AGC ACC670 43 sebSb seb 64.82 M11118 634TCG CAT CAA ACT GAC AAA CG653 3 sebSp seb 61.1 M11118 662 GTAT GTA TGG TGG TGT AAC TGA GC685 43 sebAp seb 60.06 M11118 831 CA CCA AAT AGT GAC GAG TTA GG810 43 sebAb seb 60.4 M11118 924CAT GTC ATA CCA AAA GCT ATT CTC901 3 secSb sec 62.5 X05815 664 G CTC AAG AAC TAG ACA TAA AAG CTA GG690 3 secSp sec 63.13 X05815 772AAC GG(/a)C AAT ACT TTT TGG TAT GAT795 3 secAp sec 61.4 X05815 885 CTT CAC A(/t)CT TTT AGA ATC AAC CG863 43 secAb sec 60.4 X05815 935TCA AAA TCG GAT TAA CAT TAT CC913 3 sedSb sed 60.2 M28521 332CTA GTT TGG TAA TAT CTC CTT TAA ACG358 3 sedSp sed 64.91 M28521 360TAA AGC CAA TGA AAA CAT TGA TTC A384 3 sedAp sed 60.85 M28521 491CTT TTA TTT TCT CCT ATT ATT GG ATTTTT463 30 sedAb sed 61.9 M28521 653 CAA TTA ATG CTA TAT CTT ATA GGG TAA ACA TC622 3 seeSb see 63.41 M21319 424 C GAT TGA CCG AAG AAA AAA AAG445 30 seeSp see 60.2 M21319 479 CTA CAG TAC CTA TAG ATA AAG TTA AAA CAA GC510 3 seeAp see 66.87 M21319 613TTT GCA CCT TAC CGC CAA AG594 3 seeAb see 60.38 M21319 659TAA CTT ACC GTG GAC CCT TC640 3 segSb seg 66.14 AF064773 229CAA CCC/T GAT CCT AAA TTA GAC GAA C253 2 segSp seg 63.09 AF064773 285GGG AAC TAT GGG T(/a)AA TGT AAT GAA TC310 2 segAp seg 62.61 AF064773 338CTT CCT TCA ACA GGT GGA GAC318 2 segAb seg 62.91 AF064773 485/401GGA ACG CCA AAA ATG TCT ACT T464/379 35 sehSb seh 60.86 U11702 407TTA GAA ATC AAG GTG ATA GTG GC 429 2 sehSp seh 61.25 U11702 454ACT GCT GAT TTA GCT CAG AAG TTT A 478 2 sehAp seh 60.1 U11702 575AGT GTT GTA CCT CCA TAT AGA C ATTC550 35 sehAb seh 60.47 U11702 641TTT TGA ATA CCA TCT ACC CAA AC619 2 seiSb sei 63.01 AY158703 396 G GCC ACT TTA TCA GGA CAA TAC TT419 2 seiSp sei 61.91 AY158703 656A CA C(a)TG GTA AAG GC(t)A AAG AAT ATG679 2 seiAp sei 62.26 AY158703 726AAA ACT TAC AGG CAG TCC ATC TC704 2 seiAb sei 58.23 AY158703 818AAT TAT CAT TAG TTA CTA TCT ACA TAT GAT ATT TC784 35 etaSb eta 61.39 M17347 374CTA GTG CAT TTG TTA TTC AAG ACG397 3 etaSp eta 69.51 M17347 414CCA TGC AAA AGC AGA AGT TTC AGC 437 3 etaAp eta 60.67 M17347 492TGC A(/g)TT GAC ACC ATA GTA CTT ATT C468 This study etaAb eta 62.72 M17347 794AAT GCT AAA TCA ACA CCT GC AC773 30 etbSb etb 61.26 M17348 190TAC CAC CTA ATA CCC TAA TAA TCC AA215 3 etbSp etb 61.37 M17348 286GAG ACA GTG CAT TAA ATG AAT AAC TTT312 3 etbAp etb 62.41 M17348 539GAT TTC TTC TGC GCT GTA TTC TT517 This study etbAb etb 61.16 M17348 609 C ATT ATC CGT AAT GTG TGT ATAAA GC584 43 etdSb etd 61.75 AB057421 5963GCT CGG ATA CCC TTA TAA CTT TTC5986 This study etdSp etd 62.2 AB057421 6055CTG AGT CGG GAA ATT CTG G6073 43 etdAp etd 61.47 AB057421 6120CAA CAT GAA TAC CA0A CTA ACT CTC C6096 This study etdAb etd 61.88 AB057421 6259CAT TAC TAA TGA GAC TGT AAT TCA GCT CT6231 This study tsstSb tsst-1 65.22 J02615 348AAG CCA ACA TAC TAG CGA AGG AAC371 3 tsstSp tsst-1 60.5 J02615 394GGC GTT ACA AAT ACT GAA AAA TTA C418 30 tsstAp tsst-1 64.36 J02615 495ATC GAA CTT TGG CCC(/a) ATA CTT T474 3 tsstAb tsst-1 61.03 J02615 556 GTA TTT GAG TTA GCT GAT GAC GAA533 43 pvlSb pvl 65.29 X72700 2651TTT TAG GCT CAA GAC AAA GCA AC2673 This study pvlAp pvl 65.3 X72700 2731TAC CTC TGG ATA ACA CTG GCA TTT T2707 11 pvlSp pvl 61.76 X72700 2733CTT CAA TCC AGA ATT TAT TGG TGT 2756 11 pvlAb pvl 65.8 X72700 2783TTT GCA GCG TTT TGT TTT CG2764 11 ↵ a S, sense; A, antisense; b, biotin labeled (all the primers were biotin labeled at the 5′ end); p, probe (all the probes were 5′ end C6 amine labeled).
↵ b T m values were provided by the primer synthesizer (Sigma-Aldrich).
↵ c Boldface numbers represent the numbered base positions at which primer/probe sequences start and finish (starting at point “1” of the corresponding GenBank sequence). Underlined portions indicate modifications of published primer/probe sequences. The bases in parenthesis represent sequences with polymorphisms compared with GenBank sequences or our own sequencing results (for five probes with heterogeneous hybridization).
↵ d Primers and probes were used as previously published (some with modification) except, as indicated, those designed for this study.
- TABLE 3.
Primers used for PCR sequencing of nuc, femA, and spa genes
Primer Target Tm (°C) GenBank accession no. Primer sequence (5′-3′)c nucS1a nuc 60.3 V01281 226ATGACAGAATACTTATTAAGTGCTGG251 nucS2b nuc 60.6 V01281 232GAATACTTATTAAGTGCTGGCATATG257 nucA1b nuc 63.9 V01281 908TGACCTGAATCAGCGTTGTC889 nucA2a nuc 63.7 V01281 912TTATTGACCTGAATCAGCGTTG891 femAS1a femA 64.1 X17688 577ATGAAATTAATTAACGAGAGACAAATAGGAG607 femAS2b femA 65.4 X17688 591CGAGAGACAAATAGGAGTAATGATAATGAAG621 femAA0b femA 67.3 X17688 1868CTGTCTTTAACTTTTTTAAGTGCGGTATATGC1837 femAAa femA 68.3 X17688 1878CTAAAAAATTCTGTCTTTAACTTTTTTAAGTGCGG1844 spaSa spa 71.7 J01786 1077CTT CAT CCA AAG CCT TAA AGA CGA TCC TTC1106 spaAa spa 71.4 J01786 1543CAA TTT TGTCAG CAG TAG TGC CGT TTG1517 spaSEQb spa 71.9 J01786 1540TTT TGTCAG CAG TAG TGC CGT TTG CT1515 ↵ a For most targets, outer primers were used for amplification and, less commonly, for sequencing.
↵ b Inner primers were mainly used for sequencing, since they gave better results.
↵ c Boldface numbers represent the numbered base positions at which primer sequences start and finish (starting at point “1” of the corresponding GenBank sequence).
- TABLE 4.
Comparison of discriminatory powers of each genotyping method and various combinations of methods for 42 MRSA strains using Simpson index of diversity
Genotyping method(s) No. of types % of largest type DIa Individual SCCmec 9 45.2 0.764 nuc sequence types 7 38.1 0.77 femA sequence types 9 38.1 0.794 TGPs 14 23.8 0.88 MLST 15 23.8 0.882 spa types 22 19 0.926 Combinations femA-spa-TGP 27 14.3 0.959 TGP-spa 27 14.3 0.959 TGP-spa-nuc 27 14.3 0.959 TGP-spa-SCCmec 30 9.5 0.98 femA-spa-TGP-SCCmec 31 9.5 0.981 femA-spa-TGP-nuc-MLST-SCCmec 34 9.5 0.987 ↵ a DI, Simpson index, calculated according to the method of Hunter and Gaston (16).
