Skip to main content
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems
  • Log in
  • My alerts
  • My Cart

Main menu

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About JCM
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems

User menu

  • Log in
  • My alerts
  • My Cart

Search

  • Advanced search
Journal of Clinical Microbiology
publisher-logosite-logo

Advanced Search

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About JCM
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
Virology

Detection and Typing of Human Herpesvirus 6 by Molecular Methods in Specimens from Patients Diagnosed with Encephalitis or Meningitis

Norma P. Tavakoli, Seela Nattanmai, Rene Hull, Heather Fusco, Lela Dzigua, Heng Wang, Michelle Dupuis
Norma P. Tavakoli
1Wadsworth Center, New York State Department of Health, Albany, New York
2School of Public Health, SUNY Albany, Albany, New York
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: norma.tavakoli@wadsworth.org
Seela Nattanmai
1Wadsworth Center, New York State Department of Health, Albany, New York
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Rene Hull
1Wadsworth Center, New York State Department of Health, Albany, New York
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Heather Fusco
1Wadsworth Center, New York State Department of Health, Albany, New York
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Lela Dzigua
1Wadsworth Center, New York State Department of Health, Albany, New York
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Heng Wang
1Wadsworth Center, New York State Department of Health, Albany, New York
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Michelle Dupuis
1Wadsworth Center, New York State Department of Health, Albany, New York
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
DOI: 10.1128/JCM.01692-07
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Article Figures & Data

Tables

  • TABLE 1.

    Primers and probes used in our singleplex real-time PCR assays for the detection of HHV-6 and GFP

    Primer or probeSequence
    HHV-6 forward
        primer5′ AAAATTTCTCACGCCGGTATTC 3′
    HHV-6 reverse
        primer5′ CCTGCAGACCGTTCGTCAA 3′
    HHV-6 probe6-FAM-TCGGTCGACTGCCCGCTACCA-TAMRA
    GFP forward
        primer5′ CACCCTCTCCACTGACAGAAAAT 3′
    GFP reverse primer5′ TTTCACTGGAGTTGTCCCAATTC 3′
    GFP probe6-FAM-TGTGCCCATTAACATCACCATCTAATTCAACA-TAMRA
  • TABLE 2.

    Demographic, clinical, and laboratory information for the 24 HHV-6-positive patientsa

    Patient no.Sample typePatientDays between onset and collectionDiagnosisSymptom(s)CSF informationHHV-6 real-time PCR CT valueHHV-6 typing resultTyping primer usedOther agents detected
    SexAge (yr)CSF abnormalityProtein level (mg/dl)WBC count% Lymphs
    1CSFM1210EncephalitisFever, altered mental status, hallucinationsYes56359531.78BU86
    2CSFF122EncephalitisFever, altered mental statusNo334Unknown31.98BU86
    3CSFF27EncephalitisFever, altered mental status, seizures, muscle weaknessUnknownUnknownUnknownUnknown36.07UntypedU86
    4CSFM45UnknownEncephalitisFever, headache, seizures, altered mental status, muscle weakness, muscle painYesUnknown208034.3UntypedU86
    5CSFM21EncephalitisFever, seizures, altered mental statusNo160Unknown39.3BU95
    6CSFF10UnknownFever, rash, altered mental status, increased AST/ALTYes48325038.65UntypedU86
    7CSFM20MeningitisFever, altered mental status, coughUnknown28UnknownUnknown36.5BU86
    8CSFF3031Encephalitis; acute onset psychosisHeadache, rash, altered mental status, confusion, hyperactivityYes131010032.29BU95
    9CSFM8UnknownEncephalitisSeizures, altered mental status, muscle weakness, stiff neckYes35589037.58BU95
    10CSFM3814EncephalitisFever, altered mental status, headache, stiff neckYesUnknownUnknownUnknown39.74UntypedU95EBV+ve
    11CSFF1UnknownEncephalitisSeizuresUnknownUnknownUnknownUnknown33.3BU95
    12CSF/autopsyM2UnknownEncephalitis; meningitisSeizuresUnknownUnknownUnknownUnknown38.47BU95
    13CSFM171MeningitisHeadache, stiff neck, muscle weakness, muscle painYes150402925.03BU95
    14CSFF815EncephalitisFever, headache, rash, altered mental statusUnknownUnknownUnknownUnknown33.56UntypedU95
    15CSFF40EncephalitisFever, seizures, altered mental statusNo252034.75BU95
    16CSFF83MeningitisFever, headache, stiff neck, meningeal signYes662285839.92BU95
    17Liver tissueF307UnknownFever, rash, elevated LFT result, jaundice, pruritisN/AN/AN/AN/A34BU95
    18CSFM601MeningoencephalitisFever, seizures, altered mental statusYes4999N/A28.89BU95
    19CSFM251MeningitisMuscle weaknessYes1194910028.68BU95
    20CSF/autopsyF1UnknownUnknownSickle cell disease, anemia, feverUnknownUnknownUnknownUnknown37.96BU95Adv+ve
    21CSF/autopsyM2UnknownUnknownFever, cough, bronchiolitis symptomsUnknownUnknownUnknownUnknown37.35BU95
    22CSFM718EncephalitisFever, altered mental statusYes1174710029.62UntypedU95EBV+ve
    23ACSFF316Encephalitis; cerebellitisMuscle weakness, ataxiaUnknownUnknownUnknownUnknown32.2BU95
    23BSerum27UnknownN/AN/AN/AN/A30.7BU95
    23CCSF34Headache, altered mental status, vomiting, tremorNo151Unknown36.09BU95
    24CSFM12EncephalitisFever, muscle weakness, altered mental status, seizures, rashYes28856532.9BU95
    • ↵ a F, female; M, male; AST/ALT, alanine aminotransferase/aspartate aminotransferase; LFT, liver function test; % Lymphs, number of lymphocytes as a percentage of total WBC count; N/A, not applicable; Adv, adenovirus. U86 and U95 are the genes targeted in the HHV-6 PCR typing assays. Three specimens were tested for patient 23 (A, B, and C).

PreviousNext
Back to top
Download PDF
Citation Tools
Detection and Typing of Human Herpesvirus 6 by Molecular Methods in Specimens from Patients Diagnosed with Encephalitis or Meningitis
Norma P. Tavakoli, Seela Nattanmai, Rene Hull, Heather Fusco, Lela Dzigua, Heng Wang, Michelle Dupuis
Journal of Clinical Microbiology Dec 2007, 45 (12) 3972-3978; DOI: 10.1128/JCM.01692-07

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Print

Alerts
Sign In to Email Alerts with your Email Address
Email

Thank you for sharing this Journal of Clinical Microbiology article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Detection and Typing of Human Herpesvirus 6 by Molecular Methods in Specimens from Patients Diagnosed with Encephalitis or Meningitis
(Your Name) has forwarded a page to you from Journal of Clinical Microbiology
(Your Name) thought you would be interested in this article in Journal of Clinical Microbiology.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
Detection and Typing of Human Herpesvirus 6 by Molecular Methods in Specimens from Patients Diagnosed with Encephalitis or Meningitis
Norma P. Tavakoli, Seela Nattanmai, Rene Hull, Heather Fusco, Lela Dzigua, Heng Wang, Michelle Dupuis
Journal of Clinical Microbiology Dec 2007, 45 (12) 3972-3978; DOI: 10.1128/JCM.01692-07
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Top
  • Article
    • ABSTRACT
    • MATERIALS AND METHODS
    • RESULTS
    • DISCUSSION
    • ACKNOWLEDGMENTS
    • FOOTNOTES
    • REFERENCES
  • Figures & Data
  • Info & Metrics
  • PDF

KEYWORDS

Encephalitis, Viral
Herpesvirus 6, Human
Meningitis, Viral
polymerase chain reaction
Roseolovirus Infections

Related Articles

Cited By...

About

  • About JCM
  • Editor in Chief
  • Board of Editors
  • Editor Conflicts of Interest
  • For Reviewers
  • For the Media
  • For Librarians
  • For Advertisers
  • Alerts
  • RSS
  • FAQ
  • Permissions
  • Journal Announcements

Authors

  • ASM Author Center
  • Submit a Manuscript
  • Article Types
  • Resources for Clinical Microbiologists
  • Ethics
  • Contact Us

Follow #JClinMicro

@ASMicrobiology

       

ASM Journals

ASM journals are the most prominent publications in the field, delivering up-to-date and authoritative coverage of both basic and clinical microbiology.

About ASM | Contact Us | Press Room

 

ASM is a member of

Scientific Society Publisher Alliance

 

American Society for Microbiology
1752 N St. NW
Washington, DC 20036
Phone: (202) 737-3600

 

Copyright © 2021 American Society for Microbiology | Privacy Policy | Website feedback

Print ISSN: 0095-1137; Online ISSN: 1098-660X