Detection and Typing of Human Herpesvirus 6 by Molecular Methods in Specimens from Patients Diagnosed with Encephalitis or Meningitis

Norma P. Tavakoli; Seela Nattanmai; Rene Hull; Heather Fusco; Lela Dzigua; Heng Wang; Michelle Dupuis

doi:10.1128/JCM.01692-07

DOI: 10.1128/JCM.01692-07

Article Figures & Data

Tables

TABLE 1.

Primers and probes used in our singleplex real-time PCR assays for the detection of HHV-6 and GFP

Primer or probe	Sequence
HHV-6 forward
primer	5′ AAAATTTCTCACGCCGGTATTC 3′
HHV-6 reverse
primer	5′ CCTGCAGACCGTTCGTCAA 3′
HHV-6 probe	6-FAM-TCGGTCGACTGCCCGCTACCA-TAMRA
GFP forward
primer	5′ CACCCTCTCCACTGACAGAAAAT 3′
GFP reverse primer	5′ TTTCACTGGAGTTGTCCCAATTC 3′
GFP probe	6-FAM-TGTGCCCATTAACATCACCATCTAATTCAACA-TAMRA

TABLE 2.

Demographic, clinical, and laboratory information for the 24 HHV-6-positive patients^a

Patient no.	Sample type	Patient		Days between onset and collection	Diagnosis	Symptom(s)	CSF information				HHV-6 real-time PCR C_T value	HHV-6 typing result	Typing primer used	Other agents detected
Patient no.	Sample type	Sex	Age (yr)	Days between onset and collection	Diagnosis	Symptom(s)	CSF abnormality	Protein level (mg/dl)	WBC count	% Lymphs	HHV-6 real-time PCR C_T value	HHV-6 typing result	Typing primer used	Other agents detected
1	CSF	M	12	10	Encephalitis	Fever, altered mental status, hallucinations	Yes	56	35	95	31.78	B	U86
2	CSF	F	12	2	Encephalitis	Fever, altered mental status	No	33	4	Unknown	31.98	B	U86
3	CSF	F	2	7	Encephalitis	Fever, altered mental status, seizures, muscle weakness	Unknown	Unknown	Unknown	Unknown	36.07	Untyped	U86
4	CSF	M	45	Unknown	Encephalitis	Fever, headache, seizures, altered mental status, muscle weakness, muscle pain	Yes	Unknown	20	80	34.3	Untyped	U86
5	CSF	M	2	1	Encephalitis	Fever, seizures, altered mental status	No	16	0	Unknown	39.3	B	U95
6	CSF	F	1	0	Unknown	Fever, rash, altered mental status, increased AST/ALT	Yes	483	2	50	38.65	Untyped	U86
7	CSF	M	2	0	Meningitis	Fever, altered mental status, cough	Unknown	28	Unknown	Unknown	36.5	B	U86
8	CSF	F	30	31	Encephalitis; acute onset psychosis	Headache, rash, altered mental status, confusion, hyperactivity	Yes	13	10	100	32.29	B	U95
9	CSF	M	8	Unknown	Encephalitis	Seizures, altered mental status, muscle weakness, stiff neck	Yes	35	58	90	37.58	B	U95
10	CSF	M	38	14	Encephalitis	Fever, altered mental status, headache, stiff neck	Yes	Unknown	Unknown	Unknown	39.74	Untyped	U95	EBV+ve
11	CSF	F	1	Unknown	Encephalitis	Seizures	Unknown	Unknown	Unknown	Unknown	33.3	B	U95
12	CSF/autopsy	M	2	Unknown	Encephalitis; meningitis	Seizures	Unknown	Unknown	Unknown	Unknown	38.47	B	U95
13	CSF	M	17	1	Meningitis	Headache, stiff neck, muscle weakness, muscle pain	Yes	150	40	29	25.03	B	U95
14	CSF	F	81	5	Encephalitis	Fever, headache, rash, altered mental status	Unknown	Unknown	Unknown	Unknown	33.56	Untyped	U95
15	CSF	F	4	0	Encephalitis	Fever, seizures, altered mental status	No	25	2	0	34.75	B	U95
16	CSF	F	8	3	Meningitis	Fever, headache, stiff neck, meningeal sign	Yes	66	228	58	39.92	B	U95
17	Liver tissue	F	30	7	Unknown	Fever, rash, elevated LFT result, jaundice, pruritis	N/A	N/A	N/A	N/A	34	B	U95
18	CSF	M	60	1	Meningoencephalitis	Fever, seizures, altered mental status	Yes	49	99	N/A	28.89	B	U95
19	CSF	M	25	1	Meningitis	Muscle weakness	Yes	119	49	100	28.68	B	U95
20	CSF/autopsy	F	1	Unknown	Unknown	Sickle cell disease, anemia, fever	Unknown	Unknown	Unknown	Unknown	37.96	B	U95	Adv+ve
21	CSF/autopsy	M	2	Unknown	Unknown	Fever, cough, bronchiolitis symptoms	Unknown	Unknown	Unknown	Unknown	37.35	B	U95
22	CSF	M	71	8	Encephalitis	Fever, altered mental status	Yes	117	47	100	29.62	Untyped	U95	EBV+ve
23A	CSF	F	3	16	Encephalitis; cerebellitis	Muscle weakness, ataxia	Unknown	Unknown	Unknown	Unknown	32.2	B	U95
23B	Serum			27		Unknown	N/A	N/A	N/A	N/A	30.7	B	U95
23C	CSF			34		Headache, altered mental status, vomiting, tremor	No	15	1	Unknown	36.09	B	U95
24	CSF	M	1	2	Encephalitis	Fever, muscle weakness, altered mental status, seizures, rash	Yes	288	5	65	32.9	B	U95

↵ a F, female; M, male; AST/ALT, alanine aminotransferase/aspartate aminotransferase; LFT, liver function test; % Lymphs, number of lymphocytes as a percentage of total WBC count; N/A, not applicable; Adv, adenovirus. U86 and U95 are the genes targeted in the HHV-6 PCR typing assays. Three specimens were tested for patient 23 (A, B, and C).