Skip to main content
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems
  • Log in
  • My alerts
  • My Cart

Main menu

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About JCM
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems

User menu

  • Log in
  • My alerts
  • My Cart

Search

  • Advanced search
Journal of Clinical Microbiology
publisher-logosite-logo

Advanced Search

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About JCM
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
CASE REPORTS

Cystitis Caused by Aeromonas caviae

Khalifa Al-Benwan, Sharon Abbott, J. Michael Janda, Geert Huys, M. John Albert
Khalifa Al-Benwan
1Department of Microbiology, Al-Amiri Hospital, Kuwait City, Kuwait
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Sharon Abbott
2Microbial Diseases Laboratory, California Department of Health Services, Richmond, California
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
J. Michael Janda
2Microbial Diseases Laboratory, California Department of Health Services, Richmond, California
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Geert Huys
3Laboratory of Microbiology, Faculty of Sciences, Ghent University, Ghent, Belgium
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
M. John Albert
4Department of Microbiology, Faculty of Medicine, Kuwait University, Kuwait City, Kuwait
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: john@hsc.edu.kw
DOI: 10.1128/JCM.00480-07
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

ABSTRACT

Aeromonas sp. organisms rarely cause urinary tract infection. We report for the first time a case of urinary tract infection caused by A. caviae in an adult patient with a history of increased frequency of urination, dysuria, hematuria, and weight loss.

CASE REPORT

A 39-year-old Bangladeshi male presented to the emergency department of Al-Amiri Hospital, Kuwait, with a 2-month history of increased frequency of urination, dysuria, hematuria, and weight loss of 7 kg. Seven weeks earlier, he was treated with amoxicillin for 5 days by his general practitioner. But despite the therapy, his symptoms deteriorated.

On examination, the patient was afebrile (37°C) with normal vital signs for his age. His suprapubic area was tender. Ultrasonography of the abdomen and pelvis revealed generalized and irregular thickening (4 to 5 mm) of the wall of the urinary bladder suggestive of cystitis. A chest X-ray was normal. Hematological examination revealed a hemoglobin level of 153 g/liter, a platelet count of 170 × 109/liter, a white-cell count of 7.7 × 109/liter, and an erythrocyte sedimentation rate of 3 mm/h (all values were within the normal range). The biochemical profile revealed an alanine aminotransferase level of 57 IU/liter, alkaline phosphatase level of 76 IU/liter, creatinine level of 80 μmol/liter, and blood urea level of 2.6 mmol/liter (all were within the normal ranges). Stool culture was negative for Aeromonas spp., Salmonella spp., Shigella spp., and Campylobacter spp.

The urine analysis showed an erythrocyte level of 30/hpf and a leukocyte level of 4/hpf. The urine sample was plated on cystine-lactose-electrolyte-deficient agar, MacConkey agar, and sheep blood agar (Oxoid, Basingstoke, United Kingdom) and incubated at 37°C. After 24 h, pure growth of smooth, entire colonies of about 2 mm in diameter appeared on the plates. The concentration of bacteria was calculated to be >105 colonies/ml of urine. The colonies were non-lactose fermenters on MacConkey agar and nonhemolytic on blood agar. One purified isolate was deposited in the BCCM/LMG Bacteria Collection, Ghent University (Belgium) (http://bccm.belspo.be/db/lmg_search_form.php ) as LMG 24107. The isolate was a gram-negative, motile bacillus and was catalase and oxidase positive. The API-20E identification strip (bioMerieux, Marcy l'Etoile, France) profile obtained (3006126) identified LMG 24107 as either Vibrio fluvialis or Aeromonas caviae with differential tests of growth in KCN and growth without salt for A. caviae. Results of further biochemical characterization as described previously (1) are shown in Table 1. The extensive biochemical characterization of the isolate indicated that the isolate was not V. fluvialis (growth without salt supplementation and growth in KCN broth) and was, in fact, A. caviae. Next, we performed molecular identification of the isolate by sequencing of the 16S rRNA and gyrB genes. Bacterial DNA was extracted by the cetyltrimethylammonium bromide method (10) for 16S rRNA sequencing and by the method of Pitcher and colleagues (9) for gyrB sequencing. The entire 16S rRNA gene was amplified by the primer pair S-D-Bact-0008-a-S-20 F (5′AGAGTTTGATCCTGGCTCAG3′) and S-Univ-1492-b-A-21R (5′ACGGCTACCTTGTTACGACTT3′) as described previously (11). A gyrB fragment of approximately 1,100 bp was amplified using the primers gyrB3F and gyrB14R and sequenced using the same primers and additional primers gyrB7F, gyrB9R, and gyrB9Rs as described previously (12), using the following temperature program: initial denaturation at 95°C for 4 min, 30 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and elongation at 72°C for 60 s, and a final extension at 72°C for 7 min. The 16S rRNA and gyrB amplicons were sequenced in both directions using the BigDye v3.0 Ready Reaction cycle sequencing kit (Applied Biosystems, Foster City, CA) in an ABI PRISM 3100 Avant genetic analyzer (Applied Biosystems). Sequences were compared with the GenBank database using the BLAST program of the National Center for Biotechnology Information. Based on its 16S rRNA gene sequence, isolate LMG 24107 was confirmed as an Aeromonas member, but it could not be reliably assigned to a known species in this genus (data not shown). In contrast, partial gyrB sequence analysis indicated that LMG 24107 belonged to A. caviae DNA hybridization group 4 (HG4) as the first-choice identification based on highest gyrB sequence similarities with A. caviae HG4 strains LMG 3755 (GenBank accession no. AY 101794; 99.0% sequence similarity) and LMG 3775T (GenBank accession no. AY 101783; 97.6% sequence similarity).

View this table:
  • View inline
  • View popup
TABLE 1.

Biochemical characteristics of A. caviae isolated from urine and API-20E (bioMerieux) reactions (profile obtained, 3006126)

The antimicrobial susceptibility of LMG 24107 was studied using Mueller-Hinton agar (Oxoid) by the disk diffusion method according to NCCLS recommendations (8). The isolate was susceptible to ciprofloxacin, cefotaxime, and gentamicin and resistant to amoxicillin, cotrimoxazole, ampicillin, cefuroxime, and cephalothin.

HEp-2 cell adherence (6) and agglutination of human group O erythrocytes (3) of the isolate were studied as described previously. The isolate showed weak adherence to the HEp-2 cells but strong agglutination of erythrocytes.

The patient was given oral ciprofloxacin, 500 mg every 12 h, for 2 weeks. This resulted in improvement of hematuria, dysuria, and frequency. A repeat urine culture after completion of the antibiotic therapy did not grow any bacteria. The patient remained well during the 3-month follow-up.

This is a clear case of urinary tract infection due to A. caviae. Even though the API 20E profile identified LMG 24107 as V. fluvialis/A. caviae, detailed biochemical reactions identified it as A. caviae. Whereas 16S rRNA gene sequencing failed to place LMG 24107 in a specific Aeromonas species, gyrB sequencing confirmed the biochemical identification result and placed the isolate in HG4 of A. caviae. Collectively, these results thus reinforce the need for a polyphasic approach towards the accurate identification of clinical aeromonads at the hybridization group level. In addition, this case study further documents the usefulness of gyrB as an alternative molecular marker for the 16S rRNA gene (12), which does not allow unambiguous identification of all Aeromonas species due to its intragenomic heterogeneity (7).

Aeromonas sp. organisms rarely cause urinary tract infections. To our knowledge, there are three cases reported in the English-language articles, caused by A. hydrophila (2), A. veronii biotype sobria (4), and A. popoffii (5). The present report is the first case of urinary tract infection due to A. caviae. Our patient was otherwise apparently healthy. In other cases, there were underlying abnormalities. For example, one patient had congenital spina bifida, and therefore, urination was helped with an indwelling urethral catheter (5); another was a newborn baby with bladder and bilateral renal dilatation suggestive of urethral valve involvement (2); and the third was a 69-year-old diabetic patient (4). The common feature in all these cases was leukocyturia and bacteruria, and the urine pathology resolved with proper antimicrobial therapy in all cases.

Aeromonas sp. organisms produce a number of putative virulence factors. In the case of Escherichia coli, which is a bonafide urinary pathogen, the two known virulence factors are fimbriae and hemolysin. We found our isolate to be hemolysin negative, since the colonies were nonhemolytic on blood agar, but positive for hemagglutination and adherence to HEp-2 cells. The last two properties are suggestive of possession of fimbriae by the isolate and would have contributed to the virulence of the isolate.

Nucleotide sequence accession number.The nucleotide sequence of the gyrB gene determined in this study has been submitted to the EMBL/GenBank sequence databases and assigned the accession no. AM710394.

ACKNOWLEDGMENTS

G. Huys is a postdoctoral fellow of the Fund for Scientific Research-Flanders, Flanders, Belgium (F.W.O.-Vlaanderen).

We thank S. Haridas, M. Cnockaert, and R. Coopman for assistance with the sequencing work.

FOOTNOTES

    • Received 4 March 2007.
    • Returned for modification 22 March 2007.
    • Accepted 14 May 2007.
  • Copyright © 2007 American Society for Microbiology

REFERENCES

  1. 1.↵
    Abbott, S. L., W. K. W. Cheung, and J. M. Janda. 2003. The genus Aeromonas: biochemical characteristics, atypical reactions, and phenotypic identification schemes. J. Clin. Microbiol.41:2348-2357.
    OpenUrlAbstract/FREE Full Text
  2. 2.↵
    Bartolome, R. M., A. Andreau, M. Xercavins, R. Elcuaz, and S. Salcedo. 1989. Urinary tract infection by Aeromonas hydrophila in a neonate. Infection17:172-173.
    OpenUrlCrossRefPubMed
  3. 3.↵
    Burke, V., M. Cooper, J. Robinson, M. Gracey, M. Lesmana, P. Echeverria, and J. M. Janda. 1984. Hemagglutination patterns of Aeromonas spp. in relation to biotype and source. J. Clin. Microbiol.19:39-43.
    OpenUrlAbstract/FREE Full Text
  4. 4.↵
    Hsueh, P. R., L. J. Teng, L. N. Lee, P. C. Yang, Y. C. Chen, S. W. Ho, and K. T. Luh. 1998. Indwelling device-related and recurrent infections due to Aeromonas species. Clin. Infect. Dis.26:651-658.
    OpenUrlCrossRefPubMedWeb of Science
  5. 5.↵
    Hua, H. T., C. Bollet, S. Tercian, M. Drancourt, and D. Raoult. 2004. Aeromonas popoffii urinary tract infection. J. Clin. Microbiol.42:5427-5428.
    OpenUrlAbstract/FREE Full Text
  6. 6.↵
    Khashe, S., D. J. Scales, S. L. Abbott, and J. M. Janda. 2001. Non-invasive Providencia alcalifaciens strains fail to attach to HEp-2 cells. Curr. Microbiol.43:414-417.
    OpenUrlCrossRefPubMed
  7. 7.↵
    Morandi, A., O. Zhaxybayeva, J. P. Gogarten, and J. Graf. 2005. Evolutionary and diagnostic implications of intragenomic heterogeneity in the 16S rRNA gene in Aeromonas strains. J. Bacteriol.187:6561-6564.
    OpenUrlAbstract/FREE Full Text
  8. 8.↵
    National Committee for Clinical Laboratory Standards. 2003. Performance standards for antimicrobial disk susceptibility tests. Approved standard M2-A8. National Committee for Clinical Laboratory Standards, Wayne, PA.
  9. 9.↵
    Pitcher, D. G., N. A. Saunders, and R. J. Owen. 1989. Rapid extraction of bacterial genomic DNA with guanidium thiocyanate. Lett. Appl. Microbiol.8:151-156.
    OpenUrlCrossRefWeb of Science
  10. 10.↵
    Rogers, S. O., and A. J. Bendich. 1985. Extraction of DNA from milligram amounts of fresh herbarium and mummified plant tissues. Plant Mol. Biol.5:69-76.
    OpenUrlCrossRefPubMedWeb of Science
  11. 11.↵
    Suau, A., R. Bonnet, M. Sutren, J.-J. Godon, G. R. Gibson, M. D. Collins, and J. Dore. 1999. Direct analysis of genes encoding 16S rRNA from complex communities reveals many novel molecular species within the human gut. Appl. Environ. Microbiol.65:4799-4807.
    OpenUrlAbstract/FREE Full Text
  12. 12.↵
    Yanez, M. A., V. Catalan, D. Apraiz, M. J. Figueras, and A. J. Martinez-Murcia. 2003. Polygenetic analysis of members of the genus Aeromonas based on gyrB gene sequences. Int. J. Syst. Evol. Microbiol.53:875-883.
    OpenUrlCrossRefPubMedWeb of Science
PreviousNext
Back to top
Download PDF
Citation Tools
Cystitis Caused by Aeromonas caviae
Khalifa Al-Benwan, Sharon Abbott, J. Michael Janda, Geert Huys, M. John Albert
Journal of Clinical Microbiology Jul 2007, 45 (7) 2348-2350; DOI: 10.1128/JCM.00480-07

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Print

Alerts
Sign In to Email Alerts with your Email Address
Email

Thank you for sharing this Journal of Clinical Microbiology article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Cystitis Caused by Aeromonas caviae
(Your Name) has forwarded a page to you from Journal of Clinical Microbiology
(Your Name) thought you would be interested in this article in Journal of Clinical Microbiology.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
Cystitis Caused by Aeromonas caviae
Khalifa Al-Benwan, Sharon Abbott, J. Michael Janda, Geert Huys, M. John Albert
Journal of Clinical Microbiology Jul 2007, 45 (7) 2348-2350; DOI: 10.1128/JCM.00480-07
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Top
  • Article
    • ABSTRACT
    • CASE REPORT
    • ACKNOWLEDGMENTS
    • FOOTNOTES
    • REFERENCES
  • Figures & Data
  • Info & Metrics
  • PDF

KEYWORDS

Aeromonas
cystitis
Gram-Negative Bacterial Infections

Related Articles

Cited By...

About

  • About JCM
  • Editor in Chief
  • Board of Editors
  • Editor Conflicts of Interest
  • For Reviewers
  • For the Media
  • For Librarians
  • For Advertisers
  • Alerts
  • RSS
  • FAQ
  • Permissions
  • Journal Announcements

Authors

  • ASM Author Center
  • Submit a Manuscript
  • Article Types
  • Resources for Clinical Microbiologists
  • Ethics
  • Contact Us

Follow #JClinMicro

@ASMicrobiology

       

ASM Journals

ASM journals are the most prominent publications in the field, delivering up-to-date and authoritative coverage of both basic and clinical microbiology.

About ASM | Contact Us | Press Room

 

ASM is a member of

Scientific Society Publisher Alliance

 

American Society for Microbiology
1752 N St. NW
Washington, DC 20036
Phone: (202) 737-3600

 

Copyright © 2021 American Society for Microbiology | Privacy Policy | Website feedback

Print ISSN: 0095-1137; Online ISSN: 1098-660X