Article Figures & Data
Tables
- TABLE 1.
Clinical data, PFGE types, MLST results, and β-lactamases corresponding to the P. aeruginosa isolates studied
PFGE type (no. of isolates) Date(s) (mo/yr) of isolation Source(s) Hospital ward(s) or location MLSTa β-Lactamase pIs β-Lactamase variantsb Allelic profile ST A, subtypes 1 to 5 (37) 9/2003-1/2006 Tracheostomy tube swabs, wound swabs, urine, blood, peritoneal fluid, drainage fluid, ear swabs ICU, surgery, neurology, cardiology, internal medicine 17-5-12-3-14-4-7 ST244 5.3, 7.7, 8.2 PER-1, OXA-2, OXA-50f B, subtypes 1 and 2 (3) 2/2004-3/2004 Urine, peritoneal fluid, ear swab Surgery, neurology, nephrology 38-11-3-13-1-2-4 ST235 5.3, 6.5, 7.7, 8.2 PER-1, OXA-2, OXA-74, OXA-50g Cc (1) 7/2005 Tracheostomy tube swab Neurology 39-6-12-11-3-15-2 ST245 5.3, 7.7, 8.2 PER-1, OXA-2, OXA-50h D (2) 2/1992-3/1992 Ankara, Turkey 38-11-3-13-1-2-4 ST235 5.3, 6.5, 7.7, 8.2 PER-1,c OXA-2,d OXA-17,d OXA-50g ↵ a MLST of eight ST244 isolates, three ST235 isolates, one ST245 isolate, and two Turkish isolates was performed.
↵ b PCR analyses of the blaPER-1-, blaOXA-2-, blaOXA-10-, and blaOXA-50-like genes of all isolates were performed; full sets of amplified genes from three representative ST244 isolates and all ST235 and ST245 isolates from Warsaw were sequenced. Only the blaOXA-50-like genes from the Turkish isolates were sequenced in the present study; the other β-lactamase genes of these isolates were characterized previously (11, 12).
↵ c Reference 12.
↵ d Reference 11.
- TABLE 2.
PCR primers used to analyze β-lactamase genes
Primer designation Target gene or region Sequence (5′-3′) Purpose(s) Expected size(s) (bp) of amplicon(s) (corresponding primer)a Reference PERA bla PER-1 ATGAATGTCATTATAAAAGC PCR, sequencing 925 (PERD) 12 PERD bla PER-1 AATTTGGGCTTAGGGCAGAA PCR, sequencing 12 S bla OXA-50 type AATCCGGCGCTCATCCATC PCR, sequencing 867 (AS) 16 AS bla OXA-50 type GGTCGGCGACTGAGGCGG PCR, sequencing 16 OXA-2A bla OXA-2 ATGGCAATCCGAATCTTCG PCR, sequencing 828 (OXA-2B) This work OXA-2B bla OXA-2 TTATCGCGCAGCGTCCG PCR, sequencing This work OXA-2C bla OXA-2 CTTGAATGTCGATGCAGGC Sequencing This work OXA-2D bla OXA-2 GGTCGCAACTGGATACTGC Sequencing This work OXA-10A bla OXA-10 type (blaOXA-74) ATGAAAACATTTGCCGCATATG PCR, sequencing 801 (OXA-10B) This work OXA-10B bla OXA-10 type (blaOXA-74) TTAGCCACCAATGATGCCC PCR, sequencing This work OXA-10C bla OXA-10 type (blaOXA-74) CCTGATGCTCATTCTTTATG Sequencing This work OXA-10D bla OXA-10 type (blaOXA-74) CACCTGAATATCTAGTGCA Sequencing This work ISPa12.B GATCTCGCTTTACATTTACC PCR 1,678 (PER-1E) 42 ISPa14.B GCCTAATTCGATGCCTTAT PCR 1,993 (PER-1E) 42 PER-1E bla PER-1 GCACTGGAACACTAAACTCG PCR This work PERC bla PER-1 ACACAGCTGTCTGAAACCTC PCR 1,883 (ISPa13.A); 2,528 (ISPa14.A) 12 ISPa13.A TAACCATATGCACTCAACGG PCR 42 ISPa14.A AATCAAATGTCCAACCTGCC PCR 42 ↵ a PCR product sizes are shown in conjunction with the forward primer in each primer pair; the corresponding primer in the pair is identified in parentheses.
- TABLE 3.
Nucleotide sequences of identified blaOXA-50 alleles in the P. aeruginosa isolates studied
Strain or ST/allele Nucleotide at positiona: 9 21 36 46 66 74 96 105 126 145 282 289 327 492 500 PAO1/blaOXA-50 T T T A (Thr) C A (Gln) C G C C (Arg) G C (Arg) C (Asp) A G (Arg) DM1253/poxB27b C T (Cys) G (Glu) A (His) COL-1/blaOXA-50bc C C G (Ala) G (Arg) A T T A G ST244/blaOXA-50f C T (Cys) T (Cys) G (Glu) A (His) ST235/blaOXA-50g C C G (Ala) G (Arg) A T T A ST245/blaOXA-50h C T G (Glu) A (His) ↵ a Nucleotide positions are numbered consecutively, starting with the first ATG codon of the blaOXA-50 coding sequence. Only nucleotide differences with respect to the sequence of the blaOXA-50 gene from P. aeruginosa PAO1 (GenBank accession no. AE004964 ) (16) are shown. In cases in which polymorphisms cause amino acid differences, the amino acid symbols are given in parentheses.
- TABLE 4.
Antimicrobial susceptibilities of clinical isolatesa
Strain or ST (no. of isolates) MIC (μg/ml) of: TIC TIM PIP TZP CTX CAZ CAZ-CLA FEP ATM IPM MEM GEN TOB CIP ST244 (37) 256->512 32-256 16->256 8->256 128->256 >256 4-128 32->256 64->256 0.5->32 2->32 8->64 2->64 >32 ST235 (3) 512 256 64 64 128 128->128 16-32 64-128 128->128 8 16 >64 >64 16->16 ST245 (1) 512 32 32 16 >256 >256 32 256 >256 4 4 4 2 1 P. aeruginosa ATCC 27853 16 16 2 2 16 1 2 2 2 2 0.5 2 0.5 0.25 E. coli ATCC 25922 4 8 2 2 0.06 0.25 0.125 0.06 0.06 0.06 0.015 0.5 0.25 0.015 ↵ a Abbreviations: TIC, ticarcillin; TIM, ticarcillin with clavulanate; PIP, piperacillin; TZP, piperacillin-tazobactam; CTX, cefotaxime; CAZ, ceftazidime; CLA, clavulanate; FEP, cefepime; ATM, aztreonam; IPM, imipenem; MEM, meropenem; GEN, gentamicin; TOB, tobramycin; CIP, ciprofloxacin.