Fungal Infection in Patients with Serpiginous Choroiditis or Acute Zonal Occult Outer Retinopathy

Yeast growth.Yeasts were grown in YEPD medium (1% yeast extract, 2% peptone, and 2% glucose) with incubation at 30°C. The same medium, containing agar, was used to isolate individual Saccharomyces cerevisiae colonies.

Antibodies.Rabbit antisera against Candida famata, C. albicans, C. parapsilosis, C. glabrata, S. cerevisiae, and Rhodotorula mucilaginosa were obtained by inoculation of 0.5 ml of phosphate-buffered saline (PBS) containing 1 or 2 mg of yeast after autoclaving and lyophilization. Each inoculum had been previously mixed with the same volume of Freund's adjuvant. Rabbits were inoculated up to four times, and the antibody titer and specificity of the serum samples were tested by immunofluorescence and Western blotting.

Immunofluorescence.For C. famata, 1 ml of culture was placed in 1.5 ml microcentrifuge tubes. Cells were washed with PBS, incubated with 50 mM ammonium chloride for 10 min, and washed three times with PBS-Tween 20. Cells were then treated with the different serum samples diluted 1:500 in PBS-Tween 20 at 37°C for 2 h, washed again with PBS-Tween 20, and incubated with the secondary antibody. Rabbit anti-human fluorescein-conjugated antibody (immunoglobulin A [IgA] plus IgM plus IgG) was added at a dilution of 1:500. The cells were then washed, resuspended in PBS, and mounted on slides with a drop of Depex (Serva). Finally, the cells were observed under a fluorescence microscope. For the remaining Candida species, a Euroimmun commercial kit (Medizinische Labordiagnostika AG) was used in accordance with the manufacturer's instructions and using the same serum dilutions as for C. famata.

PCR analyses.The DNA was extracted from blood as follows. One milliliter of blood was centrifuged at 20,000 × g for 20 min. Pellets were resuspended in 1 ml of triple-distilled filtered water and were incubated at room temperature for 20 min. Samples were centrifuged for 3 min at 20,000 × g and washed twice more with triple-distilled filtered water. Pellets recovered from the last centrifugation were resuspended in 300 μl of PBS. Samples were boiled for 10 min and then incubated for 2 h at 37°C with Zimolase (ICN) and for a further 2 h at 58°C with proteinase K (Sigma). Then, 200 μl of a detergent buffer were added and samples were boiled again for 10 min before addition of 1 ml of phenol:chloroform (Amersham) (1:1) and centrifuged at 20,000 × g for 20 min. The upper aqueous phase was recovered and washed twice with ethyl ether. The DNA was precipitated by addition of 3 volumes of absolute ethanol (Merck) (−20°C) to the aqueous-phase mixture. After storage of the samples overnight at −20°C, the DNA was then centrifuged at 20,000 × g for 20 min. Pellets were dried and resuspended in water. Real-time quantitative PCR was carried out using an ABI Prism 7000 thermocycler (Applied Biosystems), as previously described (30). The reaction mixture was prepared with 0.9 μM each oligonucleotide and 0.25 μM TaqMan probe in a final volume of 20 μl, to which 50 ng of DNA was added. The concentration of the DNA template was normalized with reference to previous PCRs with specific oligonucleotides in which DNA was denatured at 95°C for 10 min and amplified for 40 cycles of 15 s at 95°C and 1 min at 60°C. PCR assays were carried out with oligonucleotides that amplify a region of the rRNA internal transcribed spacer genes. The oligonucleotides used were TaqMan 5′ TGAACCTGCGGAAGGATCAT, TaqMan 3′ ACGCAGCGAAATGCGATA, and TaqMan probe G-FAM (6-carboxyfluorescein)-TCAACAACGGATCTCTTGG-minor groove binder (MGB). Data were analyzed using SDS 7000 (1.1) software (ABI Prism).

Slot blot analyses.Different serum dilutions in Tris-buffered saline (200 μl each) were added to each well. Samples were blotted onto a 45-mm-pore-size nitrocellulose membrane (Bio-Rad) that had been previously hydrated in Tris-buffered saline for 10 min using a Bio-Dot SF apparatus (Bio-Rad). After blotting, the membrane was processed and developed as described above for Western blotting. The primary antibodies, rabbit polyclonal antibodies raised against C. famata, C. albicans, C. glabrata, C. parapsilosis, R. mucilaginosa, or S. cerevisiae, were used at a 1:1,000 dilution. We used a donkey anti-rabbit IgG horseradish peroxidase-conjugated antibody (Amersham Biosciences) at a dilution of 1:5,000 as a secondary antibody.

Description of patients.Table 1 lists the patients involved in this study. Five individuals with diagnosis of AZOOR and five with diagnosis of SC were examined. These diagnoses were made on the basis of results of funduscopic examination, fluorescein angiograms, and campimetric tests. The results with respect to severity of visual defects are summarized in Table 1. AZOOR may represent an early stage in the evolution of the disease, ultimately leading to retinal necrosis.

Assays to analyze fungal infection.There is no universal test to determine whether disseminated fungal infection is present. In order to investigate this potential infection in patients diagnosed with AZOOR or SC, we carried out analyses using serum or whole peripheral blood by examination of the following: (i) fungal growth in appropriate media; (ii) antibodies against different Candida species (assayed by immunofluorescence); (iii) fungal genomes (examined using quantitative PCR); and (iv) antigens from C. famata and other yeasts (estimated by slot blot assays). Fungal growth was negative when 200 μl of serum or whole blood was seeded in liquid or agar YEPD media.

Analysis of Candida antibodies.The presence of antibodies against C. famata, C. albicans, C. parapsilosis, C. glabrata, and C. krusei was assayed by immunofluorescence. Figure 1 illustrates the type of immunoreactions obtained with one AZOOR patient, one SC patient, and one healthy volunteer. There was clear immunoreactivity to some Candida species seen with the two patients, whereas immunoreaction was not observed with the healthy volunteer. Immunoreactivity varies according to the patient analyzed, but the results obtained with four out of five patients with AZOOR and four out of five patients with SC were positive in this test (Table 2). Not only the presence or absence of antibodies but also the Candida species recognized by the different serum samples differed from patient to patient. This variability may be dependent on the severity of the infection and the organs affected by the disseminated candidiasis. It is also possible that the yeast species infecting each patient are different. By contrast, serum samples from 12 healthy volunteers were negative for the different Candida spp. tested (Table 2).

• Open in new tab
• Download powerpoint

FIG. 1.

Analysis by immunofluorescence to detect the presence of antibodies against different yeast species in serum samples from patients. In the case of C. famata, the protocol described in Materials and Methods was followed. As a positive control, rabbit antiserum against C. famata was employed; as a negative control, PBS, instead of the primary antibody, was added. For the remaining yeast species, a Euroimmun commercial kit was used and the controls were those provided by the commercial kit. Positive and negative controls for each species are shown in the corresponding columns. AZ3, AZOOR patient 3; SC1, serpiginous choroiditis patient 1; NP, healthy donor.

Fungal genomes in whole blood analyzed by quantitative PCR.Circulating fungal genomes in blood of patients with disseminated candidiasis have occasionally been observed (3, 9, 21, 22, 33). Whether such an observation is made probably depends on the activity of fungal foci present in the different organs or tissues. Even in cases in which viable cells were not detected in blood, it might have been possible to detect fungal DNA (21, 22, 27). Thus, for one AZOOR patient, yeast DNA was evidenced by quantitative PCR (Fig. 2A). Interestingly, four SC patients were also PCR positive. In one of them, there were 12,500 copies of rRNA genes per ml of blood (Fig. 2). On the other hand, the lack of genome amplification by PCR in samples from some patients may be because potential fungal infection was not reflected in blood at the time the sample was obtained.

• Open in new tab
• Download powerpoint

FIG. 2.

Quantitative PCR analyses of whole blood. DNA was extracted from 200 μl of blood. PCR was carried out as described in Materials and Methods. Graphic shows the data obtained in numbers of fungal ribosomic RNA copies per milliliter of blood. NP1 and NP2 represent control serum samples from healthy donors. AZ1 to AZ5, AZOOR patients; SC1 to SC5, serpiginous choroiditis patients.

Analysis of fungal antigens in blood serum.We have developed a very sensitive method based on the slot blot technique to analyze C. famata antigens in human serum samples (30). Figure 3A shows the type of reaction obtained with one AZOOR and one SC patient, whereas the test results obtained with serum from a healthy donor were negative. The analysis of serum samples from all patients with this method detected the presence of these antigens at moderate levels in samples from four of the AZOOR patients, but the results for the remaining patient were negative (Fig. 3B). The tests showed high amounts of C. famata antigen in two SC patients but low amounts in the other three. In such cases, it may be that antigens are not secreted into the bloodstream or that these antigens, if present, belong to fungal species not recognized by the rabbit antibody used.

• Open in new tab
• Download powerpoint

FIG. 3.

(A) Presence of C. famata antigens in patient serum samples analyzed by slot blot. Different dilutions of serum samples were blotted onto a nitrocellulose membrane, which was incubated with the rabbit antiserum against C. famata. CONT, control sample using serum from a healthy donor; Control +, serum from a patient with chronic candidiasis; Control −, no human serum added. (B) Densitometric values of the 1,500 dilution from the slot blot analysis of serum samples from the indicated patients. The slot blot membrane was incubated with the rabbit antiserum raised against C. famata. CONT, controls. The values shown represent the median of results from 12 healthy volunteers. The bar indicates the standard deviation. AZ1 to AZ5, AZOOR patients; SC1 to SC5, serpiginous choroiditis patients.

To further investigate this possibility, rabbit antibodies were raised against other yeast species, namely, C. albicans, C. parapsilosis, C. glabrata, S. cerevisiae, and R. mucilaginosa. These antibodies were used to assay for the presence of fungal antigens in the different serum samples. As shown in Table 3, no circulating antigens immunoreacted with C. parapsilosis, S. cerevisiae, or R. mucilaginosa antibodies in AZOOR patients. Only patient 3 presented moderate antigen levels that immunoreacted in the slot blot assay using R. mucilaginosa and S. cerevisiae antibodies. Notably, the serum sample from this patient (AZOOR 3) had a high titer of the C. glabrata antigen. The fact that some patients possess antigens that immunoreact with different antibodies may be due to cross-reactivity, but we cannot discard the possibility of mixed yeast infections. In the case of SC patients, no antigens that immunoreact with S. cerevisiae and R. mucilaginosa antibodies were found. Notably, SC patient 1 was positive for C. albicans antigens, whereas the levels of C. parapsilosis antigen in patient 4 and C. glabrata antigen in patient 2 were low. In summary, apart from the presence of C. famata antigens in four AZOOR patients, the presence of high levels of C. albicans antigen in patient 1 and C. glabrata antigen in patient 3 should also be noted. SC patient 1 was positive for both C. famata and C. albicans antigens, whereas patient 5 only had C. famata antigens. Patient 2 had low levels of C. glabrata antigens only. No antigens immunoreacting with the different antibodies used were evidenced in SC patient 3. In principle, it may be possible that this patient was infected by fungal species other than the ones tested in our assay. A summary of all of the results is shown in Table 4.