Article Figures & Data
Figures
- FIG. 1.
Location of amplicon with PCR primers and probes from each laboratory (A to G) on the IS1111a insertion element.
Tables
- TABLE 1.
Overview of equipment and protocols used by the participating laboratories
Laboratory DNA extraction platform DNA isolation kit PCR platform PCR reagents Reaction vol (μl) Cycling parameterse A Manual High Pure viral nucleic acid kita LightCycler 480a LightCycler 480 Probe Mastera 20 95°C, 1 s; 60°C, 12 s (50×) B NucliSens EasyMagb NucliSens magnetic extraction reagentsb ABI Prism 7500c In-house master mix 25 95°C, 15 s; 60°C, 1 min (45×) C MagNA Pure Compact systema MagNA Pure Compact nucleic acid isolation kit Ia ABI Prism 7500 ABI Universal Master mixc 25 50°C, 2 min; 95°C, 15 s; 60°C, 1 min (45×) D MagNA Pure Compact system MagNA Pure Compact nucleic Acid isolation kit I ABI Prism 7500 ABI Universal Master mix 25 50°C, 2 min; 95°C, 15 s; 60°C, 1 min (45×) MagNA Pure LC Systema MagNA Pure LC total nucleic acid isolation kita E Manual QIAamp DNA mini kitd ABI Prism 7500 ABI Universal Master mix 30 50°C, 2 min; 95°C, 15 s; 60°C, 1 min (45×) F MagNA Pure Compact system MagNA Pure Compact nucleic acid isolation kit I LightCycler 480 LightCycler 480 Probe Master 50 95°C, 15 s; 60°C, 1 min (45×) MagNA Pure LC system MagNA Pure LC total nucleic acid isolation kit G Manual QIAamp DNA mini kit LightCycler 480 LightCycler FastStart DNA Master HybProbea 20 95°C, 10 s; 60°C, 20 s; 72°C, 15 s (45×) - TABLE 2.
Nucleotide sequences of amplification primers and detection probes used in this study.
Laboratory(ies) Formata Primer or probe Concn (μM) Sequence (5′ → 3′) Locationb Amplicon size (bp) Reference A TM QKF3 0.5 GTGGTGCCAAGCGATTTTAT 7216-7235 78 This study QKR3 0.5 GTTTCATCCGCGGTGTTAAT 7293-7274 QKP3 0.2 FAM-TTTAGCGAGCGAAGCGGTGG-TAMRA 7253-7272 B TM QFw 0.9 TGATGGAAGCGTGTGGAGG 6910-6928 87 This study QRv 0.9 CGTGCTGCGGACTGATCAAC 6996-6977 QProbe 0.2 VIC-GCGAACCATTGGTATCGGACGTTT-TAMRA 6951-6974 C, D TM 456 0.5 AAAACGGATAAAAAGAGTCTGTGGTT 7635-7660 70 13 457 0.5 CCACACAAGCGCGATTCAT 7704-7686 Coxbur 0.15 FAM-AAAGCACTCATTGAGCGCCGCG-TAMRA 7661-7683 E, F TM IS FW 0.5 AAAGTGATCTACACGAGACGGGTTA 6834-6858 75 This study IS REV 0.5 CACGCAGCCCACCTTAAGAC 6908-6889 PIS 0.2 FAM-CGTGCTCAGTATGTATC-MGB 6861-6877 G HP CbISF-2 0.5 GGACGAAGCGATTGGTGATTAC 7331-7352 202 This study CbISR-2 0.5 ACTCGAATGTTGTCGAGGG 7532-7514 CbIS1111aFL 0.2 GCGTGGGTGACATTCATCAATTTCATCG-Flu 7453-7480 CbIS1111aCT635 0.2 CFRed635-CCCGGCAGTTGTCGGCGTTTA-PO4 7483-7503 - TABLE 3.
Number of positive PCRs using a 3-fold serial dilution series of Nine Mile DNA tested with four replicates
Dilution (fold) Approximate copy no. per DNA sample (5 μl) No. of positive PCRs in laboratory: A B C D E F G 9 250 4 4 4 4 4 4 4 27 83 4 4 4 4 4 4 4 81 28 4 4 2 4 3 4 1 243 9.3 2 1 3 2 2 2 1 729 3.1 3 1 0 0 0 1 0 2,187 1.0 1 0 1 0 0 1 1 6,561 0.34 0 1 0 0 1 0 0 19,683 0.11 0 0 0 0 0 0 0 59,049 0.04 0 0 0 0 0 0 0 - TABLE 4.
Efficiency of DNA extraction methods and sensitivity of real-time PCR assays (tested in quadruplicate)
Sample DNA extraction method (laboratory) No. of positive results out of 4 PCRs in laboratory: Total % positive A B C D E F G Aa High Pure viral nucleic acid kit (A) 3 4 3 4 3 3 0 71 QIAamp DNA mini kit (E) 4 4 4 4 4 4 1 89 QIAamp DNA mini kit (G) 4 4 4 4 4 4 0 86 NucliSens EasyMag (B) 3 3 4 3 4 3 0 71 MagNA Pure Compact (C) 4 4 4 4 4 4 1 89 MagNA Pure Compact (D) 4 3 4 4 4 4 0 82 MagNA Pure Compact (F) 3 4 4 4 4 4 0 82 MagNA Pure LC system (D) 4 3 4 4 3 3 0 75 MagNA Pure LC system (F) 4 3 4 4 4 4 0 82 Total % positive 92 89 97 97 94 92 6 Bb High Pure viral nucleic acid kit (A) 2 1 2 3 1 0 0 32 QIAamp DNA mini kit (E) 2 1 3 4 3 4 0 61 QIAamp DNA mini kit (G) 1 2 3 4 4 2 0 57 NucliSens EasyMag (B) 1 1 2 0 2 1 0 25 MagNA Pure Compact (C) 3 1 4 4 2 4 0 64 MagNA Pure Compact (D) 1 0 4 3 2 3 1 50 MagNA Pure Compact (F) 2 1 2 4 4 3 0 57 MagNA Pure LC system (D) 0 1 1 2 4 1 0 32 MagNA Pure LC system (F) 1 0 2 4 0 2 0 32 Total % positive 36 22 64 78 61 56 3 - TABLE 5.
Numbers of IS1111a insertion elements with exact matches to the primer and probe sequences in the genomes of five different C. burnetii isolates
Laboratory(ies) No. of elements in strain (IS1111a copy no.): RSA493 (20) Dugway (12) RSA331 (47) CbuG Q212 (28) CbuK Q154 (48) A 20 12 43b 28 48 B 20 12 47 28 48 C, D 20 12 47 28 40e E, F 20 0a 47 28 46f G 20 12 46c 0d 8g ↵ a This involves a single nucleotide mismatch at the 5′ end of the forward primer.
↵ b This involves various mismatches in both forward and reverse primers in 4 of the 47 copies of the IS1111a insertion element.
↵ c This involves six mismatches in the reverse primer in 1 of the 47 copies of the IS1111a insertion element.
↵ d This involves a single nucleotide mismatch at a central position of the 28-base CbIS1111aFL probe.
↵ e This involves a single nucleotide mismatch at the second position of the forward primer in 8 of the 48 copies of the IS1111a insertion element.
↵ f This involves a single nucleotide mismatch and a double nucleotide mismatch in the reverse primer, both in 1 of the 48 copies of the IS1111a insertion element.
↵ g This involves a single nucleotide mismatch at the 5′ end of the reverse primer in 29 of the 48 copies of the IS1111a insertion element and various mismatches in the reverse primers in another 10 of the 48 copies of the IS1111a insertion element.
