Article Figures & Data
Figures
- FIG. 1.
espC HMA profiles of all HMA types with HMA reference strains. Each of the 7 HMA types, a1 to c, formed heteroduplexes with strain 02G82D1 (O153:HNM). Heteroduplexes were separated on homemade 7.5% polyacrylamide gels and were stained with ethidium bromide. Lanes: M, molecular size markers (100-bp ladder); 1, HMA type c, strain 02G82D1 (O153:HNM); 2, HMA type a1, KI1223 (O157:H45); 3, HMA type a2, 02G140S1 (O161:HNM); 4, HMA type a3, H37D1 (OUT:H10); 5, 10, and 11, HMA type a4, KI1317 (O127a:H6), isolated in Thailand; 6, HMA type b1, H72D5 (OUT:H6); 7, 8, 9, and 12, HMA type b2, KI1923 (O142:H6); 13, HMA type a1, 95G19D9 (O63:H6); 14, HMA type a1, KII1701 (O126:H6).
Tables
- TABLE 1.
Oligonucleotide primers used in this study
Gene Primer name Sequence (5′ → 3′)a Annealing temp (°C) No. of cycles Product length (bp) GenBank accession no. Position (bp) Reference or source of primers eae eaek1 (F) GCTTAGTGCTGGTTTAGGAT M58154 1709-1728 Nakazawa and Itoh, 1995 (28) eaek4 (R) TCGCCGTTCAGAGATCGC 55 30 489 (eaek1/eaek4) 2197-2180 Yatsuyanagi et EA-2 (R) CTCTGCAGATTAACCTCTGC 591 (eaek1/EA-2) 2299-2280 al., 1996 (35) mSK1 (F) CCGGCACAAGCATAAGC 55 30 310 M58154 1673-1689 This study eaekas_a (R) TGGCAAAATGATCTGCTG 1982-1965 espC espC 2L (F) AAACATTGGCTCTGGTGGTC 216 AF297061 6376-6395 This study espC 2R (R) CCATCCCCCGTTTTAAGATT 55 30 6591-6572 espCseq_A2 (R) AGATGTAGCATGTCCCTGCAT 634 (espC 2L/espCseq_A2) 7009-6989 This study yjaA yjaA L (F) GATCTTGTTCTGCAACTCCAC 55 30 222 CP000948 4311097-4311117 This study yjaA R (R) TGCCATGACCGCACTATC 4311318-4311301 nleB nleB L (F) GCTTTCACCGATAAGGACAAC 55 30 273 AB303062 2428-2448 This study nleB R (R) TCGCCATCAACAAAAATACC 2700-2681 efa1/lifA efa1lifA L (F) AGAATGGAAGATCACACCAG 55 30 310 AJ459584 9993-10012 This study efa1lifA R (R) ATAATGCCTTTCATCCACAC 10302-10283 ↵ a (F), forward; (R), reverse.
- TABLE 2.
Profiles of genes harbored by eae-positive E. coli (without stx) strains isolated in Japan
Pattern Presence or absencea of the following gene: nb Intimin HMA Patients Healthy individuals espC efa1/lifA yjaA nleB bfpA n Serotype(s)c (nd) n Serotype(s) (no. of strains) (A) + − − − − 1 e groupe 1 O153:HNM + − − 15 a1 2 O127a:H4, OUT:HUT 4 O142:H34, O157:HUT (2), OUT:H34 a2 2 O86a:H45, OUT:H45 c2 4 O63:H6 (2), OUT:HUT, OUT:H19 3 O63:H6 (2), O126:H6 + − + 2 a1 1 O157:H45 1 O157:H45 + + − 12 a1 3 O55:H6, OUT:H34 (2) 5 O63:HNM, OUT:H6, OUT:H10, c2 2 O63:H6, O125:H6 OUT:H21, OUT:HUT c3 1 O124:H40 1 O124:H40 + + + 3 a1 3 O157:H45 (3) Subtotal 33 19 14 (B) + + − + − 1 e group 1 O161:HNM + + + 1 a1 1 O142:H6 Subtotal 2 2 0 (C) − + − − − 4 b1 1 O26:H11 d1 1 O115:HUT 1 O115:HUT d groupf 1 O18:HUT − − + 1 b2 1 O115:HUT − + − 22 b1 9 O26:H8, O26:HNM, O103:HNM, O119:H2, O119:HNM, O153:H7, O167:H9 (2), OUT:HUT 3 O119:H2 (2), O153:H7 b groupg 1 OUT:HNM c1 8 O55:H7 (7), O55:HNM 1 O55:H7 + + − 3 b1 2 O119:H19, OUT:HNM b2 1 OUT:HUT Subtotal 30 25 5 (D) − − − − − 14 b1 3 O128:HNM, OUT:HNM (2) c2 1 O153:H19 d1 3 O119:HUT, OUT:H2, OUT:H28 3 OUT:H7, OUT:H21 (2) d2 1 OUT:H16 d group 1 OUT:H21 e1 1 OUT:HUT 1 OUT:H28 − − + 3 d1 2 O153:H21 (2) 1 O153:H21 − + − 17 a1 1 OUT:HUT b1 5 O15:H2, O111:H2, O128:H2 (2), O26:HNM 3 O128:H2 (2), OUT:H2 b group 1 O26:HNM c1 1 O145:HNM c2 2 O153:H19, O167:H19 1 OUT:H19 d1 1 O115:HNM 2 O153:HUT, OUT:HUT − + + 2 a1 1 O86a:HUT 1 O86a:HUT + − − 5 a1 2 O114:HUT, OUT:H6 a grouph 1 OUT:H6 d1 1 OUT:H7 e1 1 OUT:HNM + + − 13 a1 4 O20:H6, O20:HNM, OUT:H6 (2) 6 O20H6 (2), O20:HNM (2), b1 1 OUT:HNM OUT:H6 (2) b2 1 O157:HN b3 1 O157:H16 + + + 2 a1 1 OUT:H12 b2 1 O111:H27 Subtotal 56 37 19 Total 121 83 38 ↵ a +, presence; −, absence.
↵ b n, number of strains.
↵ c OUT, O but untypeable; HUT, H but untypeable; HNM, H but nonmotile.
↵ d Given only when greater than 1.
↵ e Intimin was not e1, although the HMA pattern belonged to the e group.
↵ f Intimin was neither d1 nor d2, although the HMA pattern belonged to the d group.
↵ g Intimin was neither b1 nor b2, although the HMA pattern belonged to the b group.
↵ h Intimin was neither a1 nor a2, although the HMA pattern belonged to the a group.
- TABLE 3.
Statistical analysis of genes associated with diarrhea
Strain groupa and gene No. of strains positive for the gene in: Pb Odds ratio 95% Confidence interval Patients Healthy individuals All strains espC 21 14 0.2093 0.581 0.255-1.324 yjaA 35 21 0.2387 0.590 0.272-1.280 nleB 53 23 0.8397 1.152 0.523-2.538 efa1/lifA 27 5 0.0274 3.182 1.117-9.064 a-EPEC strains (bfpA negative) espC 17 13 0.1714 0.523 0.218-1.255 yjaA 28 20 0.0979 0.477 0.210-1.084 nleB 46 22 1.0000 1.000 0.435-2.300 efa1/lifA 26 5 0.0233 3.391 1.173-9.807 - TABLE 4.
Relation between espC and intimin HMA types and other genes harbored
espC type by HMA Intimin (eae) type by HMA Presence or absencea of the following gene: No. of strains Total From patients From healthy individuals efa1/lifA nleB yjaA bfpA negative bfpA positive bfpA negative bfpA positive espC-a1 a1 − − + 8 2 1 4 1 − + + 9 3 3 3 a2 − − + 2 2 c2 − − + 7 4 3 − + + 2 2 c3 − + + 2 1 1 espC-a2 e + + − 1 1 espC-a3 a1 − + + 1 1 espC-b1 a1 − + + 1 1 espC-b2 a1 + + + 1 1 espC-c e − − − 1 1 All espC types 35 16 5 13 1 espC negative 86 56 6 22 2 Total 121 72 11 35 3 ↵ a +, presence; −, absence.
