Rifampin-Isoniazid Oligonucleotide Typing: an Alternative Format for Rapid Detection of Multidrug-Resistant Mycobacterium tuberculosis

Clinical isolates.Four different laboratories in Sweden, Latvia, and Argentina selected a total of 100 M. tuberculosis clinical isolates, of which 45 were MDR, 24 were monoresistant, and 31 were pan-susceptible (see Table S1 in the supplemental material). Twenty well-documented strains from the collection at the reference laboratory of the Institute of Tropical Medicine (ITM) in Belgium were used for standardization of the method.

DST.Drug susceptibility testing was performed by the reference standard proportion method in Löwenstein-Jensen medium according to standard procedures (5, 6) as well as with Bactec 460 (25) and Bactec MGIT 960 SIRE kits (Becton Dickinson, MD). The commercial test GenoType MTBDRplus (Hain Lifesciences, Nehren, Germany) for detection of drug resistance-conferring mutations was used according to the manufacturer's instructions.

DNA extraction.The strains were cultured on solid medium (Löwenstein-Jensen or Middlebrook agar) for 4 weeks at 37°C. One loopful of M. tuberculosis culture was suspended in 100 μl of distilled water and boiled for 30 min. Further, the suspension was centrifuged at 16,000 × g for 5 min, the supernatant was recovered, and 10 μl of 3 M sodium acetate, pH 4.8, and 250 μl of cold ethanol were added. After incubation at −20°C for 60 min, the sample was centrifuged, and the pellet was washed with 200 μl of 70% ethanol; the tubes were left to dry at room temperature after the supernatant was discarded. Dried DNA samples were shipped code labeled and evaluated blindly. Prior to use, pellets were resuspended in 50 μl of TE (10 mM Tris, pH 8.0, 1 mM EDTA) buffer and quantified in a Nanodrop 2000 spectrophotometer (Thermo scientific).

DNA sequencing.Rifampin-isoniazid oligonucleotide typing results were compared to those of DNA sequencing and the GenoType MTBDRplus (Hain Lifesciences, Nehren, Germany). The analysis with the GenoType MTBDRplus was carried out according to the manufacturer's instructions. Sequencing of the rpoB gene was performed as described previously (10), whereas katG sequencing was performed as follows. An approximately 700-bp fragment was amplified using 200 nM (each) katG primers F768 (5′ CATGAACGACGTCGAAACAG) and R1458 (5′ GCTACCACGGAACGACGAC). The PCR mix also contained 1.5 μM MgCl₂, 5 μl of 10× PCR buffer, 1 U of AmpliTaq Gold DNA polymerase (Applied Biosystems), and 200 μM each deoxynucleoside triphosphate (dNTP; Applied Biosystems, United Kingdom). To each reaction mixture, 10 ng of DNA template was added, and the mixture was initially denatured at 95°C for 10 min, cycled 30 times (at 95°C for 30 s, 52°C for 30 s, and 72°C for 1 min), and finally extended at 72°C for 7 min. Using a GFX PCR DNA and gel band purification kit (Amersham Pharmacia Biotech Inc.), the PCR products were purified and subsequently used as templates for cycle sequencing. Cycle sequencing was performed with katG primers F768 and R1458 using a BigDye Terminator Cycle Sequencing Ready Reaction Kit and separated in an ABI 3130xl Genetic Analyzer (Applied Biosystems). Retrieved katG sequences were aligned to the H37Rv katG sequence (accession number Rv1908c) using the ClustalW algorithm.

Design of primers and probes.Primers designed for the specific amplification of the hot spot region of the rpoB gene and for the most prevalent katG and inhA mutations associated with INH resistance are shown in Table 1. The 5′ reverse primers were labeled with biotin in order to detect the hybridization signals.

Multiplex PCR assay.The conditions used for the multiplex PCR were as follows: a 25-μl final reaction volume consisted of 66 mM Tris-HCl, 1.5 mM MgCl₂, 1.25 U of Taq DNA polymerase (CorpoGen, Colombia), 0.2 μM each primer, 0.3 mM each dNTP, and 20 ng of DNA. Cycling conditions began with an initial denaturation step at 94°C for 5 min, followed by 40 cycles of denaturation at 94°C for 30 s, annealing at 62°C for 30 s, and extension at 72°C for 30 s. A final extension step consisted of 10 min at 72°C. The presence of amplified DNA fragments was confirmed by gel electrophoresis using 1.5% agarose gel in TAE buffer (40 mM Tris-acetate and 1 mM EDTA, pH 8.3).

RIOT.The oligonucleotide probes listed in Table 2, all of them 18 bases in length, were attached to a Biodyne C membrane (Pall Corp.) using a previously described methodology (13, 14, 23). Three complete sets, each consisting of five RIF- and four INH-specific probes, were attached to each membrane using a miniblotter of 45 slots (Immunetics). For sample probing, 10 μl of each PCR-amplified product was diluted in 150 μl of TMAC buffer (3 M TMAC, 0.1% SDS, 1 mM EDTA, 10 mM Na₃PO_4, pH 6.8), denatured at 96°C for 5 min, and cooled on ice. The heat-denatured single-stranded PCR products were applied on the membrane mounted in the miniblotter. Of the 45 slots in the apparatus, 2 were reserved for positive (strain H37Rv pan-susceptible) and negative (water) controls, and the first and the last slots were filled with 170 μl of TMAC buffer. The remaining 41 slots were available for sample probing, and any eventually unused slot was filled with buffer. Hybridization was carried out at 52°C for 60 min. The membrane was washed twice at 52°C for 15 min in 10 ml of TMAC buffer. The chemiluminescent detection was made by autoradiography with a KPL DNA detection kit following the manufacturer's instructions (KPL, Inc.). All samples were evaluated in triplicate.

Statistical analysis.The performances of RIOT, DNA sequencing, and MTBDRplus were compared to that of conventional DST for the detection of RIF and INH resistance. Sensitivity, specificity, and accuracy were calculated. Data were analyzed using GraphPad Prism, version 5 (GraphPad Software Inc.). Cohen's kappa coefficient that allows estimation of agreement, taking into account the amount of agreement occurring at random (9, 15), and the positive and negative predictive values were used to evaluate the performance of each probe.

Multiplex PCR assay.In order to render the assay user friendly and to minimize hands-on time, a multiplex PCR for the simultaneous amplification of rpoB, katG, and inhA target genes was standardized. As shown in Fig. 1, simultaneous amplification of all gene segments was satisfactory in this multiplex assay. Although larger amplicons corresponding to the inhA gene showed lower band intensity than amplification of the individual gene, the hybridization signal was not affected.

• Open in new tab
• Download powerpoint

FIG. 1.

Amplified PCR products of rpoB, katG, and inhA gene targets after electrophoresis in agarose gel. The individual amplifications of gene regions and the multiplex (MPX) assay are shown consecutively. Each pair of lanes corresponds to amplified DNA product of a clinical sample (left) and reference strain M. tuberculosis H37Rv (right).

RIOT specificity, sensitivity, and accuracy.The designed platform allows the analysis of up to 41 samples in triplicate plus a positive and a negative control in a single run. Figure 2 shows a scanned image of a membrane where absence of hybridization signal indicates a mutated strain. No definite discrepancy was observed between triplicates in a single membrane, and an ambiguous hybridization signal was resolved by consensus of the other two replicates. RIOT identified 40 out of 45 (89.0%) MDR-TB isolates identified by DST. Compared with DST, the sensitivity, specificity, and accuracy rates of RIOT for RIF resistance detection were 93.0%. For INH resistance detection, the values were 87.7% sensitivity, 97.7% specificity, and 92.0% accuracy. Sequencing and MTBDRplus results showed 56 isolates with RIF resistance-associated mutation, of which RIOT detected 54. The sensitivity and specificity of our assay for RIF resistance detection compared with sequencing and MTBDRplus were 96.4% and 95.5%, respectively, with an accuracy of 96.0%. As for detection of INH-associated mutation, sensitivity and specificity were 92.7% and 100%, respectively, with an accuracy of 96.0%. Noticeably, two phenotypically RIF-resistant isolates did not have any mutation in the 81-bp hot spot region of rpoB as detected by DNA sequencing and RIOT. Also, one isolate susceptible to INH by DST had a mutation in codon 315 of katG identified by RIOT, MTBDRplus, and DNA sequencing (Table 3).

• Open in new tab
• Download powerpoint

FIG. 2.

Scanned image of the reverse line blot hybridization assay (RIOT). Lanes 1 to 36 correspond to clinical isolates with assorted mutations. Lane N, negative control; lane P, positive wild-type control (reference strain M. tuberculosis H37Rv). Blank lanes between 13 and 14 and between 26 and 27 correspond to unused slots. Three sets of nine rows each represent technical triplicates of probes for drug resistance-associated mutations. A grid designed on a transparent film is overlaid on the membrane to aid analysis of results. inhA S-15 corresponds to the probe inhA SW15.

Performance of individual probes.The performance of each probe was assessed by measuring the agreement of the test in comparison with DNA sequencing by Cohen's kappa coefficient and positive and negative predictive values (PPV and NPV, respectively). Kappa values ranged from 0.92 to 1.0, indicating an overall high degree of agreement with sequencing results. In particular, probes rpoB 4W and inhA SW15 exhibiting high kappa values but low PPV should be redesigned in a future version of the assay (Table 4).