Skip to main content
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems
  • Log in
  • My alerts
  • My Cart

Main menu

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About JCM
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems

User menu

  • Log in
  • My alerts
  • My Cart

Search

  • Advanced search
Journal of Clinical Microbiology
publisher-logosite-logo

Advanced Search

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About JCM
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
Bacteriology

Prevalence and Associations of tcpC, a Gene Encoding a Toll/Interleukin-1 Receptor Domain-Containing Protein, among Escherichia coli Urinary Tract Infection, Skin and Soft Tissue Infection, and Commensal Isolates

Marjanca Starčič Erjavec, Blaž Jesenko, Živa Petkovšek, Darja Žgur-Bertok
Marjanca Starčič Erjavec
Department of Biology, Biotechnical Faculty, University of Ljubljana, Večna pot 111, Ljubljana 1000, Slovenia
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: marjanca.starcic.erjavec@bf.uni-lj.si
Blaž Jesenko
Department of Biology, Biotechnical Faculty, University of Ljubljana, Večna pot 111, Ljubljana 1000, Slovenia
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Živa Petkovšek
Department of Biology, Biotechnical Faculty, University of Ljubljana, Večna pot 111, Ljubljana 1000, Slovenia
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Darja Žgur-Bertok
Department of Biology, Biotechnical Faculty, University of Ljubljana, Večna pot 111, Ljubljana 1000, Slovenia
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
DOI: 10.1128/JCM.01227-09
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Article Figures & Data

Tables

  • TABLE 1.

    Sequences of primers used in this study

    Functional categoryPrimerPrimer sequence (5′ to 3′)Reference
    Phylogenetic groupChuA.1GACGAACCAACGGTCAGGAT 2
    ChuA.2TGCCGCCAGTACCAAAGACA
    YjaA.1TGAAGTGTCAGGAGACGCTG
    YjaA.2ATGGAGAATGCGTTCCTCAAC
    TspE4C2.1GAGTAATGTCGGGGCATTCA
    ToxinsTspE4C2.2CGCGCCAACAAAGTATTACG
        Cytotoxic necrotizing factor (cnf1)CNF1-1CTGACTTGCCGTGGTTTAGTCGG 6
    CNF1-2TACACTATTGACATGCTGCCCGGA
        Hemolysin A (hlyA)hlyA.1AACAAGGATAAGCACTGTTCTGGCT
    hlyA.2ACCATATAAGCGGTCATTCCCGTCA
    Fimbriae and/or adhesins
        P-fimbrial adhesin II (papGII)papG_II fGGGATGAGCGGGCCTTTGAT 4
    papG_II rCGGGCCCCCAAGTAACTCG
        P-fimbrial adhesin III (papGIII)papG_III fCCACCAAATGACCATGCCAGAC 15
    papG_III rGGCCTGCAATGGATTTACCTGG
        S fimbriae (sfaDE)SFA-1CTCCGGAGAACTGGGTGCATCTTAC 7
    CGGAGGAGTAATTACAAACCTGGCA
        Afa/Dr adhesins (afa/draBC)afa/draBC-fGGCAGAGGGCCGGCAACAGGC 3
    afa/draBC-rCCCGTAACGCGCCAGCATCTC
    Iron uptake
        Aerobactin synthesis (iucD)Aer1TACCGGATTGTCATATGCAGACCGT 15
    Aer2AATATCTTCCTCCAGTCCGGAGAAG
    Other
        Uropathogenic strain-specific protein (usp)N6ATGCTACTGTTTCCGGGTAGTGTGT 8
    N7CATCATGTAGTCGGGGCGTAACAAT
        TIR domain-containing protein (tcpC)tcpC forGGCAACAATATGTATAATATCCT
    tcpC revGCCCAGTCTATTTCTGCTAAAGA 1
  • TABLE 2.

    Distribution of phylogenetic groups and virulence factors in relation to the presence of tcpC

    Phylogenetic group or virulence factorPrevalence (no. [%] of strains)a
    UTI + SSTI isolates UTI isolates SSTI isolates Commensal isolates
    tcpC positive (49 [23])tcpC negative (163 [77])tcpC positive (23 [21])tcpC negative (87 [79])tcpC positive (26 [25])tcpC negative (76 [75])tcpC positive (7[8])tcpC negative (83 [92])
    Phylogenetic group
        A5 (10)35 (21)0 (0)28 (32)**5 (19)7 (9)0 (0)20 (24)
        B13 (6)13 (8)0 (0)6 (7)3 (12)7 (9)0 (0)13 (16)
        B240 (82)81 (50)***23 (100)32 (37)***17 (65)49 (64)7 (100)23 (28)**
        D1 (2)34 (21)**0 (0)21 (24)*1 (4)13 (17)0 (0)27 (33)
    Virulence factor
        cnf1 33 (67)25 (15)***16 (70)9 (10)***17 (65)16 (21)**4 (57)1 (1)**
        hlyA 33 (67)26 (16)***18 (78)10 (11)***15 (58)16 (21)*5 (71)2 (2)***
        papGIII 19 (39)10 (6)***11 (48)3 (3)***8 (31)7 (9)3 (43)0 (0)**
        papGII 13 (27)34 (21)11 (48)26 (30)2 (8)8 (11)0 (0)7 (8)
        sfaDE 33 (67)30 (18)***19 (83)7 (8)***14 (54)23 (30)7 (100)8 (10)***
        afa/draBC 0 (0)3 (2)0 (0)2 (2)0 (0)1 (1)0 (0)4 (5)
        iucD 24 (49)70 (43)13 (57)33 (38)11 (42)37 (49)2 (29)33 (40)
        usp 44 (90)49 (30)***22 (96)26 (30)***22 22 (85)23 (30)*6 (86)1 (1)***
        Average virulence score4.061.524.78, 1.333.19, 1.723.86, 0.67
    • ↵ a The P values obtained following Bonferroni correction are indicated by asterisks when P is <0.05, as follows: *, P < 0.05; **, P < 0.005; ***, P < 0.0005.

PreviousNext
Back to top
Download PDF
Citation Tools
Prevalence and Associations of tcpC, a Gene Encoding a Toll/Interleukin-1 Receptor Domain-Containing Protein, among Escherichia coli Urinary Tract Infection, Skin and Soft Tissue Infection, and Commensal Isolates
Marjanca Starčič Erjavec, Blaž Jesenko, Živa Petkovšek, Darja Žgur-Bertok
Journal of Clinical Microbiology Feb 2010, 48 (3) 966-968; DOI: 10.1128/JCM.01227-09

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Print

Alerts
Sign In to Email Alerts with your Email Address
Email

Thank you for sharing this Journal of Clinical Microbiology article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Prevalence and Associations of tcpC, a Gene Encoding a Toll/Interleukin-1 Receptor Domain-Containing Protein, among Escherichia coli Urinary Tract Infection, Skin and Soft Tissue Infection, and Commensal Isolates
(Your Name) has forwarded a page to you from Journal of Clinical Microbiology
(Your Name) thought you would be interested in this article in Journal of Clinical Microbiology.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
Prevalence and Associations of tcpC, a Gene Encoding a Toll/Interleukin-1 Receptor Domain-Containing Protein, among Escherichia coli Urinary Tract Infection, Skin and Soft Tissue Infection, and Commensal Isolates
Marjanca Starčič Erjavec, Blaž Jesenko, Živa Petkovšek, Darja Žgur-Bertok
Journal of Clinical Microbiology Feb 2010, 48 (3) 966-968; DOI: 10.1128/JCM.01227-09
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Top
  • Article
    • ABSTRACT
    • ACKNOWLEDGMENTS
    • FOOTNOTES
    • REFERENCES
  • Figures & Data
  • Info & Metrics
  • PDF

KEYWORDS

Escherichia coli
Escherichia coli Infections
Escherichia coli Proteins
Skin Diseases, Bacterial
Soft Tissue Infections
Urinary Tract Infections
virulence factors

Related Articles

Cited By...

About

  • About JCM
  • Editor in Chief
  • Board of Editors
  • Editor Conflicts of Interest
  • For Reviewers
  • For the Media
  • For Librarians
  • For Advertisers
  • Alerts
  • RSS
  • FAQ
  • Permissions
  • Journal Announcements

Authors

  • ASM Author Center
  • Submit a Manuscript
  • Article Types
  • Resources for Clinical Microbiologists
  • Ethics
  • Contact Us

Follow #JClinMicro

@ASMicrobiology

       

ASM Journals

ASM journals are the most prominent publications in the field, delivering up-to-date and authoritative coverage of both basic and clinical microbiology.

About ASM | Contact Us | Press Room

 

ASM is a member of

Scientific Society Publisher Alliance

 

American Society for Microbiology
1752 N St. NW
Washington, DC 20036
Phone: (202) 737-3600

 

Copyright © 2021 American Society for Microbiology | Privacy Policy | Website feedback

Print ISSN: 0095-1137; Online ISSN: 1098-660X