Article Figures & Data
Figures
- FIG. 1.
Dendrogram of the 44 B. hyodysenteriae MLVA types found in the present study and clustered using UPGMA. Roman numerals I to VI indicate clonal complexes defined at the single-locus variant level. The scale bar represents genetic distance as the absolute number of differences in marker alleles among genotypes. Bootstrap values of ≥40% are shown.
- FIG. 2.
MLVA types (circled) and relationships found among them according to the goeBURST algorithm. Solid lines show the single-locus variant level, dashed lines show the double-locus variant level, and dotted lines show the triple-locus variant level. Groups at the single-locus variant level are indicated by roman numerals I to VI.
Tables
- TABLE 1.
Primers and thermocycling programs used for MLVA of B. hyodysenteriae
Locus Primer direction,a sequence (5′→3′) Thermocycling programb Bhyo_6 F, AAATATAACTCATATTCATAACAAG 30 × (94°C for 20 s, 52°C for 20 s, 72°C for 30 s), 72°C for 5 min R, AGAGAACTTCAAAAAACTTC Bhyo_7 F, AAGTAATAAATTAAAAAATCTCTAGGGTGG 30 × (94°C for 20 s, 59.5°C for 20 s, 72°C for 30 s), 72°C for 5 min R, GGTTTGGTAGAACAATCTGC Bhyo_12 F, CGTATGATTATTTTACTTGTCAG 30 × (94°C for 30 s, 59°C for 30 s, 74°C for 40 s) R, TTTTATTACAGCAACTTTACTC Bhyo_17 F, TTTTTGCCATAAATATCTCTC 30 × (94°C for 30 s, 59°C for 30 s, 74°C for 40 s) R, GAAATGCCGTCCTTCTTAG Bhyo_21 F, AAAATAATGATGAAGTATCTAATG 30 × (94°C for 20 s, 52°C for 20 s, 72°C for 30 s), 72°C for 5 min R, AAGTATCAGGTAAAGGTAAATC Bhyo_22 F, AGATTAAAAACTGACGGAG 30 × (94°C for 30 s, 55°C for 30 s, 72°C for 60 s), 72°C for 5 min R, AGCACAAGAACCTTCAAAC Bhyo_10 F, CTCTCTTTTATATTTTTTATTATAGTTG 30 × (94°C for 30 s, 55°C for 30 s, 72°C for 40 s), 72°C for 5 min R, TTGATGAAATTAGACCATTC Bhyo_23 F, CACCCTTTAGACTTATTATTTTATTTTG 30 × (94°C for 30 s, 55°C for 30 s, 72°C for 40 s), 72°C for 5 min R, TTGTTCTGCGTGCGTGTAG - TABLE 2.
Features of the loci included in the MLVA
Locus Size (bp) of: Positiona Repeat Flanking region Bhyo_6 156 78 1236667-1237672 Bhyo_7 135 177 1818959-1819765 Bhyo_10 111 88 1754196-1755095 Bhyo_12 105 59 2949083-2949421 Bhyo_17 76 175 1690628-1691034 Bhyo_21 33 195 1396843-1397034 Bhyo_22 30 153 2597474-2597543 Bhyo_23 26 102 1838685-1838736 ↵ a Location of the VNTR loci in the chromosome of the reference strain B. hyodysenteriae WA1R.
Supplemental material
Files in this Data Supplement:
- Supplemental file 1
-
Table S1 (Descriptions of the 174 B. hyodysenteriae isolates and strains used in the study)
Zipped MS Word document, 21K. - Supplemental file 2
-
Table S2 (The MLVA type definitions used and their frequencies)
Zipped MS Word document, 8K.
- Supplemental file 1
-
Table S1 (Descriptions of the 174 B. hyodysenteriae isolates and strains used in the study)
