Identification of Variable-Number Tandem-Repeat (VNTR) Sequences in Acinetobacter baumannii and Interlaboratory Validation of an Optimized Multiple-Locus VNTR Analysis Typing Scheme

Christine Pourcel; Fabrizia Minandri; Yolande Hauck; Silvia D'Arezzo; Francesco Imperi; Gilles Vergnaud; Paolo Visca

doi:10.1128/JCM.02003-10

DOI: 10.1128/JCM.02003-10

Article Figures & Data

Figures

Tables
Additional Files

Open in new tab
Download powerpoint
Fig. 1.
Allele polymorphisms at L-repeat (A) and S-repeat (B) VNTR loci. The study code of each strain is shown above the lanes, and the size of the repeat unit is reported for each VNTR marker. The amplicon from the reference strain ACICU was loaded after each DNA size marker and used as an internal control for band size optimization. The asterisks denote amplification failures. The number of repeats is indicated below each DNA band. The PCR products were analyzed in 2% agarose gels (A; lanes M show the 100-bp ladder) or in 3% agarose gels (B; lanes M show the 20-bp ladder). Electropherograms shown in the figure were obtained in center II.
Open in new tab
Download powerpoint
Fig. 2.
Typing concordance between MLVA-8 and PFGE typing or SG profiling. Cluster analysis of 25 A. baumannii strains analyzed by PFGE following ApaI digestion is shown on the left. The dendrogram was generated using the Dice coefficient and UPGMA clustering, with a 1.5% tolerance limit and 1.5% optimization as standard settings (23). The PFGE types were defined at a similarity threshold of ≥85% (28). SG and MLVA-8 allelic profiles are provided for direct comparison. The boxes denote strains belonging to the same PFGE type or MLVA-8 complex. Gel images were analyzed with BioNumerics version 5.1 software. PFGE type and SG profile determinations were performed in center II. Abbreviations: D, diversity; R, reproducibility; E, epidemiological concordance; ICL, international clonal lineage; NA, not assigned; N, new SG profile.

Table 1.

Characteristics of A. baumannii strains used in this study

Study code	Strain designation	Country of origin	Source	Yr of isolation	Relevant characteristics and molecular type^{^a}	Reference
1	ACICU^{^b}	Italy	Cerebrospinal fluid	2005	Complete genome sequenced, related to international clonal lineage II^{^c}	12
2	ACICU^{^b}	Italy	Cerebrospinal fluid	2005	Duplicate of above	12
3	ATCC 17978^{^b}	France	Respiratory secretions	1951	Complete genome sequenced	26
4	ATCC 17978^{^b}	France	Respiratory secretions	1951	Duplicate of above	26
5	AYE^{^b}	France	Urine	2001	Complete genome sequenced, related to international clonal lineage I^{^d}	31
6	AYE^{^b}	France	Urine	2001	Duplicate of above	31
7	SDF^{^b}	France	Human body louse	2001	Complete genome sequenced	31
8	SDF^{^b}	France	Human body louse	2001	Duplicate of above	31
9	RUH134	Netherlands	Urine	1982	Prototypic strain for international clonal lineage II	17
10	33C^{^e}	Italy	Wound swab	2004	SG1, related to international clonal lineage II^{^c}	5
11	53C^{^e}	Italy	Urine	2004	SG1, related to international clonal lineage II^{^c}	5
12	71C^{^e}	Italy	Environmental	2004	SG1, related to international clonal lineage II^{^c}	5
13	RUH875	Netherlands	Urine	1984	Prototypic strain for international clonal lineage I	17
14	51C	Italy	Respiratory secretions	2004	SG2, related to international clonal lineage I^{^c}	5
15	57C	Italy	Respiratory secretions	2004	SG2, variant subtype within international clonal lineage I^{^c}	5
16	82D^{^e}	Italy	Wound swab	2004	SG2, related to international clonal lineage I^{^c}	5
17	84D^{^e}	Italy	Urine	2004	SG2, related to international clonal lineage I^{^c}	5
18	85D^{^e}	Italy	Respiratory secretions	2004	SG2, related to international clonal lineage I^{^c}	5
19	RUH5875	Netherlands	Unknown	1997	Prototypic strain for international clonal lineage III	34
20	A377	Germany	Unknown	2001–2004	SG3, RAPD type 21, PFGE type XI,^{^f} unrelated to any international clonal lineage	28
21	A374	Netherlands	Unknown	2001–2004	SG profile 4, RAPD type 19, PFGE type X,^{^f} related to international clonal lineage III	28
22	A399	Turkey	Unknown	2001–2004	SG profile 4, RAPD type 20, PFGE type X,^{^f} related to international clonal lineage III	28
23	A461	Portugal	Unknown	2001–2004	SG profile 4, RAPD type 22, PFGE type XIV,^{^f} unrelated to any international clonal lineage	28
24	A376	Austria	Unknown	2001–2004	SG profile 5, RAPD type 17, PFGE type XIII,^{^f} unrelated to any international clonal lineage	28
25	A389	Denmark	Unknown	2001–2004	SG profile 5, RAPD type 12, PFGE type XV,^{^f} unrelated to any international clonal lineage	28
26	A388	Greece	Unknown	2001–2004	SG profile 6, RAPD type 7, PFGE type IV,^{^f} unrelated to any international clonal lineage	28
27	A457	Estonia	Unknown	2001–2004	SG profile 7, RAPD type 24, PFGE type XII,^{^f} unrelated to any international clonal lineage	28
28	50C	Italy	Respiratory secretions	2004	SG profile 4, variant subtype within international clonal lineage II^{^c}	5
29	105C	Italy	Cerebrospinal fluid	2005	New SG profile,^{^c} unrelated to any international clonal lineage	5

↵a SG or SG profile, RAPD fingerprint, and PFGE type.
↵b Reproducibility panel. Duplicates of four reference strains were used to assess intralaboratory reproducibility.
↵c Previously determined by D'Arezzo et al. (5).
↵d Previously determined by Turton et al. (30).
↵e Epidemiological concordance panel. Strains 33C and 53C were isolated from two patients during the same outbreak, and 71C was isolated from the associated environment. Strains 82D, 84D, and 85D were isolated from different patients during the same outbreak.
↵f PFGE type as previously determined by Towner et al. (28).

Table 2.

Oligonucleotide primers, PCR conditions, and characteristics of VNTRs analyzed in this study

VNTR marker	Position^{^a}	Expected amplicon size (bp [no. of repeats]) for strain^{^d}:						Repeat size (bp)	Size of flanking regions (bp)^{^c}	Primer designation	Primer sequence (5′–3′)	PCR conditions		Source or reference
VNTR marker	Position^{^a}	ACICU	ATCC 17978	AYE	SDF	AB0057^{^b}	AB307-0294^{^b}	Repeat size (bp)	Size of flanking regions (bp)^{^c}	Primer designation	Primer sequence (5′–3′)	Annealing temp (°C)	Elongation time (s)	Source or reference
Abaum_3406	3406043–3406564	ND	522 (10)	669 (15)	ND	549 (11)	ND	30	231	Abaum_3406_L	`CACTATATTGAAGTGCTTTTA`	50	45	This study
										Abaum_3406_R	`GTGGTTTTTCTATTGGTACATTAC`	50	45	This study
Abaum_3530	3529446–3529907	522 (7)^{^e}	462 (6)	462 (6)	ND	462 (6)	462 (6)	60	121	Abaum_3530_L	`TGCAACCGGTATTCTAGGAAC`	55	45	This study
										Abaum_3530_R	`CCTTGAACAACATCGATTACTGGA`	55	45	This study
Abaum_3002	3001898–3002379	482 (7)	539 (8)^{^e}	482 (7)	428 (6)	483 (7)	482 (7)	57	121	Abaum_3002_L	`GACTGAAGCAAGACTAAAACGT`	55	45	This study
										Abaum_3002_R	`TCTGGGCAGCTTCTTCTTGAGC`	55	45	This study
Abaum_2240	2240480–2239857	826 (4)	624 (2)	723 (3)	625 (2)	723 (3)	722 (3)	99	494	Abaum_2240_L	`CCCGCAGTACATCATGGTTC`	55	60	This study
										Abaum_2240_R	`AGAACATGTATACGCAACTG`	55	60	This study
Abaum_1988	1988034–1988228	291 (9)	195 (5)	213 (5.5)	136 (3)	213 (5.5)	213 (5.5)	26	77	Abaum_1988_L	`GGCAAGGCATGCTCAAGGGCC`	55	45	This study
										Abaum_1988_R	`CAGTAGACTGCTGGTTAATGAG`	55	45	This study
Abaum_0826	826475–826223	322 (13)^{^e}	379 (19)^{^e}	358 (17)	349 (16)	277 (8)	283 (8)	9	208	Abaum_0826_L	`TGACTACTGAAACAGTTTTTG`	50	45	This study
										Abaum_0826_R	`ATGATTGTACCGAGTAAAAGA`	50	45	This study
Abaum_0017	17531–17706	202 (14)	239 (18)^{^e}	175 (11)	185 (12)	274 (22)	274 (22)	9	80	Abaum_0017_L^{^f}	`GTGAGGGTAGAGTATTTGCTC`	55	45	Alias VNTR-1
										Abaum_0017_R^{^f}	`GAGTTAGGGAGTCTTTTATATGG`	55	45	Alias VNTR-1
Abaum_0845	845900–846018	175 (10)^{^e}	119 (2)	238 (19)	217 (16)	189 (12)	308 (29)	7	105	Abaum_0845_L	`AATTTTAATTCCAAATTGCTCC`	50	45	This study
										Abaum_0845_R	`ACTTAAAATCGCATTTTTATCA`	50	45	This study
Abaum_2396	2396729–2396935	225 (20)^{^e}	219 (19)^{^e}	231 (21)	147 (7)	159 (9)	201 (16)	6	105	Abaum_2396_L^{^f}	`CAAGTCCAATCAACTCATGATG`	55	45	Alias VNTR-10
										Abaum_2396_R^{^f}	`CTCCTGTAAGTGCTGTTCAGCC`	55	45	Alias VNTR-10
Abaum_3468	3468315–3468539	225 (13)	225 (13)	231 (14)	189 (7)	231 (14)	225 (13)	6	147	Abaum_3468_L	`CAGAAGTCACTGCATCTGCAAC`	55	45	This study
										Abaum_3468_R	`CGGTTGAAATTTTTTATAATGAAG`	55	45	This study

↵a First to last nucleotide, encompassing forward and reverse primers, relative to the genome sequence of A. baumannii ATCC 17978.
↵b Strains for which the genome sequence was considered only for in silico prediction of VNTR markers.
↵c Values referred to the genome of strain ATCC 17978 and considered for allele assignment.
↵d ND, not detected.
↵e Amplicon size and number of repeats were determined upon resequencing of the genomic region.
↵f Primers differ from those used by Turton et al. (29).

Table 3.

HGDI for individual or combined (MLVA-8) VNTR loci, PFGE types, and SG profiles calculated for 21 unrelated A. baumannii strains (diversity panel)

VNTR marker or analysis	No. of alleles or types	HGDI
L-repeat VNTR loci
Abaum_3530	2	0.39
Abaum_3002	3	0.57
Abaum_2240	4	0.73
Abaum_1988	5	0.68
S-repeat VNTR loci
Abaum_0826	9	0.88
Abaum_0845	12	0.95
Abaum_2396	12	0.94
Abaum_3468	9	0.87
MLVA-8	21	1.00
PFGE typing	14	0.95
SG profiling	8	0.89

Additional Files

Figures
Tables

Supplemental material

Files in this Data Supplement:

Supplemental file 1 - Table S1 (Comparison of VNTR analysis of A. baumannii between two centers)
Zipped MS Word document, 23K.
Supplemental file 2 - Table S2 (Features of the VNTR loci in the reference A. baumannii strains ATCC17978, ACICU, AYE, and SDF)
Zipped MS Word document, 8K.
Supplemental file 3 - Table S3 (Localization and predicted coding functions of the VNTR markers in the sequenced A. baumannii genomes)
Zipped MS Word document, 14K.
Supplemental file 4 - Preliminary protocol for MLVA typing of A. baumannii by use of capillary electrophoresis equipment
MS Word document, 26K.
Supplemental file 5 - Table S4 (Composition of the three multiplex PCRs for capillary gel electrophoresis analysis of A. baumannii small VNTR loci according to their size ranges and different dye label compatibilities)
MS Word document, 46K.