Rapid Molecular Microbiologic Diagnosis of Prosthetic Joint Infection

Charles Cazanave; Kerryl E. Greenwood-Quaintance; Arlen D. Hanssen; Melissa J. Karau; Suzannah M. Schmidt; Eric O. Gomez Urena; Jayawant N. Mandrekar; Douglas R. Osmon; Lindsay E. Lough; Bobbi S. Pritt; James M. Steckelberg; Robin Patel

doi:10.1128/JCM.00335-13

DOI: 10.1128/JCM.00335-13

Article Figures & Data

Figures

Tables
Additional Files

Open in new tab
Download powerpoint
Fig 1
Positive microbiologic results (albeit not necessarily concordant with respect to the organism detected) for patients with prosthetic joint infection. Superscript symbol definitions: a, cases 200 (Mycobacterium abscessus), 298 (Staphylococcus aureus), and 369 (polymicrobial, including S. aureus); b, cases 164 (Capnocytophaga canimorsus), 236 (Candida albicans), and 211, 259, and 425 (all three S. aureus); c, cases 214, 250, 280, and 379; d, cases 74, 110, 217, 226, 286, 352, and 430; e, cases 70, 91, 153, 203, 207, 212, 269, 300, 342, 343, 381, 396, 412, and 429.

Table 1

Real-time PCR assay panel design

Target organism^a	Target gene	Fragment size (bp)	Forward/reverse primer sequences (5′–3′)	Probe sequences (5′–3′)^b	Mg²⁺ concn (mM)	Primer concns (forward/reverse, in μM)	Cycling parameters			Limit of detection (CFU/ml of sonicate fluid)	% inclusivity^c	% cross-reactivity^c
Target organism^a	Target gene	Fragment size (bp)	Forward/reverse primer sequences (5′–3′)	Probe sequences (5′–3′)^b	Mg²⁺ concn (mM)	Primer concns (forward/reverse, in μM)	Anneal temp (°C)	Anneal time (s)	No. of cycles	Limit of detection (CFU/ml of sonicate fluid)	% inclusivity^c	% cross-reactivity^c
Staphylococcus (22)	tuf^d	447	`CAATGCCACAAACTCG`/`GCTTCAGCGTAGTCTA`	`ACGGCCTGTAGCAACAGTAC`-FL,^e LC640-`CGACCAGTGATTGAGAATACGTCC^e`, `GGCGATGCTCAATACGAAGAAAAAATC`-FL,^f LC705-`AGAATTAATGGAAGCTGTAGATAC^f`	3	1/1	55	8	36	550 SCN IDRL-7,371, 325 S. aureus ATCC 43300	100 (201/201)	0 (0/153)
Streptococcus	rpoB^g	137	`CCGGHCGTCACGGWAA`/`CCATACCAAGRTGAAGYTCCATA`	`GGAACGCCAGTTGATATCATGYTKAAYCC`-FL, LC640-`CTTGGGGTGCCATCACGKATGAA`	4	0.4/4	57	15	35	110 S. agalactiae, 115 S. pneumoniae	100 (15/15)^h	0 (0/339)
Enterococcus/Granulicatella/Abiotrophia	rpoB	143	`CGYGAAGCYGGCGATGAAT`/`AWGGCATRTCTTCTTCYGGC`	`CAYGAAGGRGATAARATGGCSGG`-FL, LC640-`GTCAYGGWAATAAAGGGGTYGTWTC`	4	0.4/4	55	8	35	200 E. faecalis	100 (14/14)ⁱ	0 (0/340)
Enterobacteriaceae other than Proteus	rpoB	185	`TCTGCWATYGAAGAAGGCAACT`/`ATCAGGGAHGCACCRAC`	`GCTTGTTCAGCCGCGACC`-FL, LC640-`GTTGACTACATGGACGTATCCACCCAGC`	3.5	0.4/2	55	8	35	190 E. coli	83.3 (20/24)^j	0 (0/330)
Gram-positive anaerobic cocci	16S rRNA	162	`TCGCGTCYSATTAGCTAGT`/`GCTGCATCAGRGTTYCC`	`CACATTGGRACTGAGAHACGGY`-FL, LC640-`ARACTCCTACGGGAGGCAGCAG`	2.5	0.4/2	57	8	35	10 F. magna	100 (12/12)	0 (0/342)
Propionibacterium/Actinomyces	16S rRNA	243	`CGGATTTATTGGGCGTAAAGR`/`AGGGTATCTAAGCCTGTTCG`	`GGCGAAGGCGGTTCTCTG`-FL, LC640-`CCTTTCCTGACGCTGAGRAGCG`	2.5	0.4/2	55	8	35	200 P. acnes	100 (52/52)^k	0.3 (1/302)^l
P. aeruginosa (21)	gyrB^m	222	`CCTGACCATCCGTCGCCACAAC`/`CGCAGCAGGATGCCGACGCC`	`GGCGAGACCGATGGCT`-FL, LC640-`GGCACCGAAGTTCACTTCAAGCCG`	2.5	0.4/1	55	8	35	200	100 (10/10)	0 (0/344)
Corynebacteriumⁿ (20)	Kinaseⁿ^,^o	143 (forward/reverse 1), 149 (forward/reverse2)	`CGRTTGTACCARGARCGGT`/`GCACCTSAAYCCSCGT` (reverse 1), `CAACGAGCACCTSAACCC` (reverse 2)	`TAGCGCTGGAAGTACCASGAGGT`-FL, LC640-`GACTCRCGCGGCGACGG`, LC705-`GACTCGCGCTCGGAAGG`	4	0.4/2	57	10	35	200 C. tuberculo-stearicum, 440 C. jeikeium	80 (4/5)^p	0 (0/349)
Proteus	rpoB	183	`CTGTCWGCAATTGAAGAAGGTAACT`/`GGATCAGTGAWGCACCGA`	`CTTGCCGTCATARAGGYG`-FL, LC705-`TCAAGYTTATTTAGTCGTGAT`	2.5	0.4/2	55	8	35	52 P. vulgaris	100 (4/4)	0 (0/350)
B. fragilis group	leuB^q	185	`CGTCCTGAGATAGAACG`/`GCAGCATTATCCACAAACATATAA`	`CTTGCTTCCAGTCGTCTATGGA`-FL, LC640-`CAGATTGCACAAGAAATGGCGCCGC`	2.5	0.4/2	55	8	35	150 B. fragilis	92.3 (12/13)^r	0 (0/341)

↵a References are given in parentheses.
↵b FL, fluorescein; LC640, LightCycler Red 640; LC705, LightCycler Red 705.
↵c Calculated based on 354 isolates.
↵d tuf, elongation factor Tu.
↵e PanStaphHP1 and HP2, probes that detect Staphylococcus aureus and SCN.
↵f SAtufHP1 and HP2, S. aureus-specific probes.
↵g rpoB encodes the β-subunit of RNA polymerase.
↵h S. agalactiae positive, with a T_m of 63°C, compared to T_ms of <60°C for other Streptococcus spp.
↵i The G. adiacens (n = 3) and Abiotrophia species isolates had T_ms of 58°C and 50°C, respectively, compared to 55°C for the Enterococcus sp. isolate.
↵j The four negative isolates were Morganella morganii, Pantoea agglomerans, Providencia rettgeri, and Serratia liquefaciens.
↵k The Actinomyces spp. had T_ms of ≤56°C, compared to 61 to 63°C for Propionibacterium spp.
↵l Corynebacterium amycolatum positive, with a T_m of 58°C.
↵m gyrB encodes DNA gyrase B.
↵n This assay uses one forward and two reverse primers and three probes in the same reaction, primer reverse 1 and probe LC705-GACTCGCGCTCGGAAGG, specific for the resistant species (C. jeikeium and C. urealyticum).
↵o Polyphosphate kinase gene, corresponding to pvdS2 of C. jeikeium K411 (NC_007164).
↵p Corynebacterium group F1 negative.
↵q leuB encodes β-isopropylmalate dehydrogenase.
↵r B. caccae negative.

Table 2

Isolates, from patients with biofilm-associated disease, that were used for analytical assay validation^a

Group and species	No. of isolates (total n = 354)
Staphylococcus spp.	201
S. aureus	85
Coagulase-negative Staphylococcus spp.	116
S. epidermidis	80
S. lugdunensis	16
S. warneri	8
S. capitis	3
S. caprae	3
S. simulans	3
Other^b	3
Propionibacterium spp.	41
P. acnes	29
P. avidum	10
P. granulosum	2
Enterobacteriaceae	28
Escherichia coli	5
Enterobacter cloacae	4
Proteus mirabilis	3
Klebsiella pneumoniae	3
Klebsiella oxytoca	2
Other^c	11
Streptococcus spp.	15
S. agalactiae	3
S. dysgalactiae	3
S. pyogenes	2
S. pneumoniae	2
S. salivarius	2
Other^d	3
Bacteroides fragilis group	13
B. fragilis	8
B. thetaiotaomicron	2
Other^e	3
Gram-positive anaerobic cocci	12
Finegoldia magna	8
Other^f	4
Actinomyces spp.^g	11
Pseudomonas aeruginosa	10
Enterococcus faecalis	9
Corynebacterium spp.^h	5
Granulicatella adiacens	3
Abiotrophia defectiva	2
Otherⁱ	4

↵a Categories shown in boldface were targeted with specific assays.
↵b Includes one S. haemolyticus, one S. hominis, and one S. saprophyticus isolate.
↵c Includes one Citrobacter freundii, one C. koseri, one E. aerogenes, one Morganella morganii, one Pantoea agglomerans, one P. vulgaris, one Providencia rettgeri, one Salmonella sp., one Serratia liquifaciens, one S. marcescens, and one Shigella flexneri isolate.
↵d Includes one S. anginosus, one S. mitis, and one S. mutans isolate.
↵e Includes one B. caccae, one B. distasonis, and one B. ovatus isolate.
↵f Includes one Peptoniphilus asaccharolyticus, one P. harei, one Parvimonas micra, and one Anaerococcus prevotii isolate.
↵g Includes three A. neuii, three A. odonolyticus, two A. naeslundii, one A. meyeri, one A. viscosus, and one A. radingae isolate.
↵h Includes one C. amycolatum, one C. simulans, one C. propinquum, one Corynebacterium sp. group F1, and one C. afermentans.
↵i Includes one Candida parapsilosis, one Dermabacter hominis, one P. fluorescens, and one S. saccharolyticus isolate.

Table 3

Characteristics of the 434 patients with or without PJI

Characteristic	Value for patient group		P value
Characteristic	Patients with aseptic failure (total n = 290)	Patients with prosthetic joint infection (n = 144)	P value
Age (yrs)			0.53
Median	68	66
Range	24–91	31–92
Gender [n (%)]			0.14
Male	131 (45.2)	76 (52.8)
Female	159 (54.8)	68 (4..2)
Reason for primary arthroplasty [n (%)]			0.43
Osteoarthritis	208 (71.7)	108 (75)
Bone fracture or trauma	44 (15.2)	19 (13.2)
Inflammatory joint disorder^a	20 (6.9)	8 (5.5)
Avascular necrosis	12 (4.1)	3 (2.1)
Congenital abnormality	2 (0.7)	4 (2.8)
Other^b	4 (1.4)	2 (1.4)
Second (or more) revision [n (%)]			0.004
No	177 (61.0)	67 (46.5)
Yes	113 (39.0)	77 (53.5)
Hardware removal [n (%)]			1.00
Partial	14 (4.8)	6 (4.2)
Complete	276 (95.2)	138 (95.8)
Risk factor for PJI [n (%)]			0.002
Diabetes mellitus	35 (12.1)	33 (22.8)	0.003
Long-term use of immunosuppressive therapy^c	2 (0.7)	4 (2.8)	0.10
Site of arthroplasty [n (%)]			0.87
Knee	181 (62.4)	91 (63.2)
Hip	109 (37.6)	53 (36.8)
Antecedent antimicrobial therapy [n/total no. evaluated (%)]	24/284 (8.4)	58/134 (43.3)	<0.0001
Diagnostic criterion for PJI
Acute inflammation [n/total no. evaluated (%)]	0/290 (0)	90/112 (80.4)
Purulence [n (%)]	0	112 (77.8)
Sinus tract [n (%)]	0	39 (27.1)
Preoperative laboratory findings [n/total no. evaluated (%)]
Blood leukocyte count > 10 × 10⁹/liter^d^,^e	17/231 (7.4)	21/123 (17.1)	0.005
Erythrocyte sedimentation rate > 30 mm/h^d^,^f	44/266 (16.5)	83/135 (61.5)	<0.0001
Serum C-reactive protein > 10 mg/liter^d^,^f	53/266 (19.9)	109/136 (81.2)	<0.0001
Synovial fluid leukocyte count > 1,700/μl^f^,^g	33/140 (23.6)	63/71 (88.7)	<0.0001
Synovial fluid differential > 65% neutrophils^f^,^g	15/137 (10.9)	61/71 (85.9)	<0.0001

↵a Includes rheumatoid arthritis, ankylosing spondylitis, and systemic lupus erythematosus.
↵b Includes bone neoplasia, arthrofibrosis, polymyalgia rheumatica, reflex sympathetic dystrophy, and acromegaly.
↵c Includes corticosteroids, methotrexate, and tumor necrosis factor inhibitors.
↵d The cutoff was taken from Bernard et al. (23).
↵e Within one preoperative week.
↵f Within six preoperative months.
↵g The cutoff was taken from Trampuz et al. (24), a study that excluded patients with underlying inflammatory joint diseases or connective tissue diseases and evaluated only knee arthroplasties.

Table 4

Comparison of microbiologic tests for diagnosis of PJI

Test	No. of patients with positive specimens and:		Sensitivity (95% CI)	Specificity (95% CI)	Positive predictive value (95% CI)	Negative predictive value (95% CI)
Test	Aseptic failure (n = 290)	PJI (n = 144)	Sensitivity (95% CI)	Specificity (95% CI)	Positive predictive value (95% CI)	Negative predictive value (95% CI)
Synovial fluid culture^a	5/161	59/89	66.3 (55.5–76.0)	96.9 (92.9–99.0)	92.2 (82.7–97.4)	83.9 (77.8–88.8)
Tissue culture
Any growth	45	119	82.6 (75.4–88.4)	84.5 (79.8–88.5)	72.6 (65.1–79.2)	90.7 (86.6–93.9)
≥2 positive tissues (same organism)	6	101	70.1 (62.0–77.5)	97.9 (95.6–99.2)	94.4 (88.2–97.9)	86.9 (82.7–90.3)
Sonicate fluid culture	5	105	72.9 (64.9–80.0)	98.3 (96.0–99.4)	95.5 (89.7–98.5)	88.0 (83.9–91.3)
Sonicate fluid PCR (10-assay panel)
Any positive result	6	111	77.1 (69.3–83.7)	97.9 (95.6–99.2)	94.9 (89.2–98.1)	89.6 (85.7–92.7)
Staphylococcus species	2	75
S. aureus	0	28
Coagulase-negative staphylococci	2	47
Streptococcus species	3	11
Enterococcus/Granulicatella/Abiotrophia species	0	11
Enterobacteriaceae	1	8
Gram-positive anaerobic cocci	0	8
Propionibacterium species	0	8
P. aeruginosa	0	5
Corynebacterium species	0	4
C. jeikeium/C. urealyticum	0	0
Non-C. jeikeium species	0	4
Proteus species	0	1
B. fragilis group	0	0

↵a Denominators are smaller for synovial fluid cultures because samples from fewer patients were submitted for this test.

Additional Files

Figures
Tables

Files in this Data Supplement:

Supplemental file 1 -
Tables S1 (Characteristics of 33 subjects classified as having prosthetic joint infection who had negative results for sonicate fluid bacterial PCR) and S2 (Discordant results between sonicate fluid PCR and culture)

PDF, 304K